2020-01-03 06:19:06
Muhammad Arif1 · Naeem Rashid1 · Sumera Perveen1 · Qamar Bashir1 · Muhammad Akhtar2
Received: 21 May 2018 / Accepted: 24 September 2018 / Published online: 27 September 2018
© Springer Japan KK, part of Springer Nature 2018
Introduction
A correlation between thermostability and the ratio of preferred (Glu and Lys) and avoided (Gln and His) amino acids (Farias and Bonato 2003) was observed. l-Tryptophan biosynthesis from chorismic acid involves fve structurally diferent enzymes encoded by seven different genes; namely anthranilate synthase (EC 4.1.3.27, AS, encoded by trpE and trpG genes), anthranilate phosphoribosyl transferase (EC 2.4.2.18, PRT, encoded by trpD gene), phosphoribosyl anthranilate isomerase (EC 5.3.1.24, PRAI, encoded by trpF gene), indole-3-glycerol-phosphate synthase (EC 4.1.1.48, InGPS, encoded by trpC gene) and tryptophan synthase (EC 4.2.1.20, TS, encoded by trpB and trpA genes) (Crawford 1987).
In the ffth step of tryptophan synthesis, InGPS converts 1-(o-carboxyphenylamino) 1-deoxyribulose 5-phosphate (CdRP) into indole-3-glycerol phosphate (IGP) by decarboxylation and dehydration reactions (Schlee et al. 2013).
The mechanism of this reaction is delineated from crystal structures of the InGPS of Escherichia coli (Wilmanns et al. 1990), Thermotoga maritima (Knöchel et al. 2002) and Sulfolobus solfataricus (Knöchel et al. 1996; Hennig et al. 2002). Moreover, kinetics experiments conducted on InGPS from E. coli (Bisswanger et al. 1979; Cohn et al. 1979), Mycobacterium tuberculosis (Czekster et al. 2009) and S. solfataricus (Schlee et al. 2013) also played an important role in elucidating the underlying mechanism.
Biochemical characteristics of InGPS have been reported from all the three domains of life including eukaryotes (Prantl et al. 1985; Horng et al. 1989; Jin et al. 2016), bacteria (Hoch 1979; Priestle et al. 1987; Sterner et al. 1996; Knöchel et al. 2002; Yang et al. 2006; Czekster et al. 2009; Bagautdinov and Yutani 2011), and archaea (Knöchel et al. 1996; Tang et al. 1999; Schlee et al. 2013, 2018). Although this enzyme has been characterized from a few members of hyperthermophilic archaea, no report is available from genus Pyrococcus. Recent advancements in genome sequencing have resulted in the accumulation of primary sequence data including the genes involved in tryptophan synthesis. InGPS homologue gene is found on the genome of a well-studied hyperthermophilic archaeon Pyrococcus furiosus; however,
the protein has not been isolated yet and the direct proof that the gene actually encodes a functional thermostable InGPS is still missing. In this study, we describe gene cloning and characterization of recombinant InGPS from P. furiosuswhose complete genome has been determined (Maeder et al. 1999).
Materials and methods
Bacterial strains, vectors, and chemicals
Escherichia coli strains DH5α and BL21-CodonPlus(DE3)-RIL were obtained from Stratagene, USA. Expression vector pET-28a(+) was purchased from Novagen, USA. All other materials and chemicals including cloning vectors, restriction enzymes and DNA purifcation kits were procured from Thermo Fisher Scientifc, USA or Sigma-Aldrich, USA or Fluka Chemicals, UK. Gene-specifc oligonucleotid primers were commercially synthesized from Macrogen, Korea.
Gene cloning and construction of expression vector
The gene (locus PF1711) encoding PfInGPS was amplifed by polymerase chain reaction using gene-specifc forward primer (5′-CCATGGTGATTTTTGGACTGAGCA GGGC) and reverse (5′ TTATATCTCAGCCTCCACGAATTTTTTG) primers. The underlined sequence shows the recognition site of restriction enzyme NcoI. The amplifed DNA product was ligated in pTZ57R/T cloning vector using the T4 DNA ligase (Thermo Fisher Scientifc). The resulting recombinant plasmid, pTZ-PfInGPS, was digested with NcoI (incorporated by PCR) and HindIII (multicloning site of pTZ57R/T) and ligated in pET 28a(+) expression vector utilizing the same restriction sites (NcoI and HindIII). The resulting plasmid was named as pET-PfInGPS.
Gene expression and purifcation of recombinant
PfInGPS
Escherichia coli BL21-CodonPlus(DE3)-RIL cells were transformed using pET-PfInGPS plasmid and grown at 37 °C in Luria–Bertani (LB) broth containing 80 μg/mL kanamycin. When the optical density (λ 660 nm) of the culture reached 0.4–0.5, the expression of the gene was induced by 0.25 mM isopropyl-β-d-1-thiogalactopyranoside (IPTG). The cell pellet (3 g wet cell mass from one liter culture), obtained by centrifugation, was resuspended in 50 mM Tris–HCl bufer (pH 8.0) followed by sonication to disrupt the cells. Cell disruption was performed for 30 cycles of sonication on ice. Each cycle consisted of a burst of 30 s of sonication with 1 min of intermittent cooling interval.
Soluble and insoluble fractions were separated by centrifugation at 12,000×g for 10 min. The soluble fraction was subjected to heat treatment at 85 °C for 25 min. The heat-labile proteins of E. coli cells, precipitated after heat treatment, were separated by centrifugation at 20,000×g for 20 min. The soluble fraction, after heat treatment, was treated with 60% (fnal concentration) ammonium sulphate. The precipitated proteins were resuspended in 50 mM Tris–HCl pH 8.0 and dialyzed against the same bufer. ÄKTA Purifer chromatography system (GE Healthcare) was used for further purifcation of recombinant PfInGPS. The dialyzed sample was subjected to anion exchange chromatography by HiTrap Q FF (GE Healthcare) column. The proteins bound to the column were eluted using a linear gradient of 0–1 M NaCl.
The fractions, after HiTrap Q FF, containing PfInGPS were pooled and dialyzed against 50 mM Tris–HCl pH 8.0 and further purifed by Resource Q column (GE Healthcare) in a similar way as was done with HiTrap Q FF. Purifed PfInGPS was quantifed spectrophotometrically and purity was monitored by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Preparation of substrate (CdRP) and enzyme assay CdRP was prepared by mixing 1 M anthranilic acid (27.4 mg dissolved in 0.2 mL absolute ethanol) and 1 M disodium ribose 5-phoshate (54.8 mg dissolved in 0.2 mL water) and stored in dark for 14 h. A tenfold dilution was made with fnal approximate pH value of 5.0. The diluted sample was incubated in the dark at room temperature for an hour to hydrolyze residual PRA followed by removal of residual anthranilic acid by three times extraction in 5 mL of saturated ethyl acetate. Prepared CdRP was stable for several weeks at −20 °C.
PfInGPS activity assay mixture (1 mL) contained 0.2 M sodium phosphate bufer (pH 5.5), 0.1 mM substrate (CdRP) and 20 μg of recombinant PfInGPS. After incubation for 1 min at the required temperature, 55 °C for routine assays, increase in absorbance at 280 nm was recorded in a cuvette of 1 cm path length. The increase in absorbance indicated the formation of 1-C-(indol-3-yl)-glycerol 3-phosphate (InGP) (ε280nm 5,450 M−1 cm−1). One unit of InGPS activity was defned as the amount of enzyme needed to produce of 1 µmol of InGP in one min.
Circular dichroism analysis
Structural stability of PfInGPS against temperature was monitored by circular dichroism (CD) spectroscopy using Chirascan™-Plus CD Spectrometer (Applied Photophysics, UK). CD spectra of PfInGPS samples, prepared in 20 mM Tris–HCl (pH 8.0) and incubated at diferent temperatures (40–90 °C) for 10 min, were recorded in far-UV range of 205–260 nm. Solvent spectra were subtracted from those of
the protein samples.
Chemical denaturation studies
PfInGPS at a fnal concentration of 24 μM, prepared in different concentrations of urea or guanidinium hydrochloride (0–8 M fnal concentration), was incubated at room temperature for 30 min. Residual InGPS activity of the enzyme was examined as described above.
Results and discussion
The trpC gene (locus PF1711) encoding InGPS in P. furiosus consists of 684 nucleotides corresponding to a protein of 228 amino acids with a calculated molecular mass of 25,307 Da and an isoelectric point of 6.8. Highest identity of 83% was found with its counterpart from Thermococcus chitonophagus followed by 82 and 79% with the enzymes from Pyrococcus abyssi and Thermococcus litoralis, respectively. Among the characterized enzymes, highest identity of 78% was found with InGPS from Thermococcus kodakarensis.
Previously, it has been identified that some archaeal proteins, such as aspartyl-tRNA synthetase and TATAbinding protein from hyperthermophilic archaeon T. kodakarensis, are relatively more similar in structure to human aspartyl-tRNA synthetase and Saccharomyces cerevisiaez TATA-binding protein, respectively, compared to bacterial counterparts (Imanaka et al. 1995; Rashid et al. 1995). We, therefore, compared InGPS from P. furiosus with the corresponding InGPS proteins from bacteria and eukaryotes and found equivalent degree of identity (38%) to the eukaryotic and bacterial counterparts. A comparison of amino acid sequences of the characterized InGPS from thermophilic bacteria and archaea demonstrated that the catalytic residues Lys112, Glu160 and Lys53 (T. thermophilus numbering) (Bagautdinov and Yutani 2011) were conserved in all these enzymes (Fig. 1). When we compared the amino acids composition of the characterized InGPS from bacterial and archaeal sources, we found that the four thermostable proteins (SsInGPS, TmInGPS, TtInGPS and PfInGPS) contain an increased fraction of Glu and a decreased fraction of Gln, Cys and His compared with the mesophilic EcInGPS (Table 1).
A correlation between thermostability and the ratio of preferred (Glu and Lys) and avoided (Gln and His) amino acids (Farias and Bonato 2003) was observed. The ratio (Glu+Lys)/(Gln+ His) is high for thermostable InGPS enzymes including PfInGPS (11.5), SsInGPS (11.0), TtInGPS (9.3) and TmInGPS (7.0), while it is much lower for thermolabile enzymes such as EcInGPS (1.1), ScInGPS (2.3), and BsInGPS (2.8). The fraction of charged residues Asp, Glu, Lys and Arg is lower in EcInGPS (22.0%) compared to TtInGPS (30.0%), TmInGPS (33.5%), SsInGPS (30.8%) and PfInGPS (31.6%). Among charged residues, the thermostable InGPS proteins contain comparatively higher Glu residue which has a tendency to form multiple ion pairs and hydrogen bonds. The higher number of charged amino acids should be important for stabilization of the exposed regions of the InGPS fold through participation in additional electrostatic interactions (Bagautdinov and Yutani 2011). No correlation of thermostability of the proteins and percentages of polar, aliphatic, aromatic or other amino acids was observed.
Cloning and expression of PfInGPS gene
Analysis of the PfInGPS gene sequence revealed the presence of NdeI recognition site at nucleotide position 131. We, therefore, introduced the NcoI recognition site at the start of the forward primer to clone the gene in pET-28a(+), so that the gene product is PfInGPS with no additional amino acid. Polymerase chain reaction using genomic DNA of P. furiosus as template and the set of primers, given in
“Materials and methods” section, resulted in amplifcation of approximately 0.7 kbp PfInGPS gene which was frst cloned in pTZ57R/T cloning vector and then in pET-28a(+) expression vector. Digestion of the recombinant plasmid, pET-PfInGPS, with the same pair of enzymes which was used for cloning (NcoI–HindIII), resulted in liberation of a 0.8 kbp DNA fragment which confrmed the presence of PfInGPS gene in the expression vector. The cloned gene was sequenced from both the strands and no mutation was detected.
Purifcation of recombinant PfInGPS
The expression of the cloned gene was examined at various concentrations of the inducer (IPTG). The protein production was optimum at an IPTG concentration of 0.25 mM. After optimizing the IPTG concentration, optimization of time after induction was carried out. A comparison of samples taken at diferent intervals of time showed a gradual increase in production of recombinant protein with passage of time till 6 h post induction. Analysis of the soluble and insoluble fractions of the cell lysate showed production of the recombinant protein in the soluble fraction (data not shown). Heat treatment, at 85 °C for 25 min, of the soluble fraction resulted in precipitation of heat-labile proteins of the host which were removed by centrifugation. The soluble fraction containing recombinant PfInGPS was brought to 60% ammonium sulphate precipitation and purifed, after dialysis against 50 mM Tris–HCl (pH 8.0), by HiTrap Q FF (5 mL) and Resource Q (6 mL) ion exchange column chromatographies, at a fow rate of 1 mL/min, which resulted in a homogeneous protein band on SDS-PAGE (Fig. 2). Final purifcation yield of PfInGPS was 79% with a purifcationfold of 5.4 (Table 2). When purifed PfInGPS was passed through Superdex 200 10/300 GL gel fltration column at a fow rate of 0.4 mL/min, the protein eluted at a retention volume of 12.1 mL. Molecular weight of the protein, determined by a standard curve obtained with ferritin (440 kDa), catalase (240 kDa), lactate dehydrogenase (140 kDa), BSA (64.5 kDa) and proteinase K (28.9 kDa), was approximately 25 kDa which indicated that recombinant PfInGPS existed in a monomeric form similar to thermostable InGPS enzymes from S. solfataricus (SsInGPS) and T. maritime (TmInGPS).
Efect of pH, temperature and denaturants on PfInGPS activity
The enzyme activity of recombinant PfInGPS, examined at various pH keeping the temperature constant, was highest at pH 5.5 (Fig. 3a) in contrast to most of the counterparts from other archaea and bacteria. To examine the efect of temperature, the enzyme activity of PfInGPS was measured at various temperatures ranging from 50 to 100 °C while keeping the pH unchanged. Highest activity was observed at 100 °C (Fig. 3b).
Thermal inactivation studies of recombinant PfInGPS at 100 °C demonstrated that the protein was highly stable at this temperature with a half-life of 200 min (Fig. 3c). The half-lives of highly thermostable enzymes from bacteria and archaea are available in literature at 90 °C. At this temperature, InGPS from hyperthermophilic bacterium T. thermotoga and archaeon S. solfataricus are less than 15 min
(Merz et al. 1999). This refects that PfInGPS is the most thermostable InGPS characterized to date. The amino acid composition of a protein determines the hydrophobic interactions which are related to the thermostability (Baldwin 2007; Pace 2009). Analysis of the amino acid composition refects that thermostable proteins contain higher number of hydrophobic residues (Table 1). The highly hydrophoboic
amino acids, Val, Leu and Ile, constitute about 28% in each of the thermostable InGPS from P. furiosus, S. solfataricusand T. maritima compared to 25% of the mesophilic counterparts from E. coli and S. cerevisiae. Thermo-labile amino acids, such as Gln and Cys, are usually avoided in thermostable enzymes (Hensel 1993; Russell and Taylor 1995). The number of these amino acids is very low (0.4%) in PfInGPS compared to the counterparts from S. solfataricus (1.6%) and T. maritime (1.6%). In the mesophilic counterpart from E. coli, they are quite high in number (7.7%). Furthermore, structural comparisons (Hennig et al. 1995; Knöchel et al. 1996, 2002) suggested that SsInGPS and TmInGPS have almost twice as many salt bridges as thermolabile InGPS from E. coli. We performed the structure comparison by
homology modeling and found that PfInGPS possesses salt bridges equivalent to SsInGPS and TmInGPS.
High thermostability of PfInGPS may be attributed to the lower content of thermo-labile amino acids, higher content of hydrophobic residues, and higher number of salt bridges. We further investigated the efect of temperature on the structure of PfInGPS by CD spectrometry. The structural stability of PfInGPS was analyzed at diferent temperatures (40–90 °C). The results showed that there was no signifcant
change in the CD spectra, indicating that PfInGPS maintains its secondary structure at all the temperatures examined (Fig. 3d).
Most of the proteins denature and lose their enzyme activities when incubated in the presence of high concentrations of denaturants such as urea or guanidine hydrochloride. However, a few proteins from hyperthermophilic archaea are reported to maintain their structures and, hence, enzyme activities in the presence of these denaturants (Rasool et al. 2010; Chohan and Rashid 2013; Gharib et al. 2016). We also activity of PfInGPS. When recombinant PfInGPS was incubated in the presence of varying concentrations of urea, there was no signifcant diference in the enzyme activity till 8 M, indicating that there was no signifcant inactivation of the protein. Similarly, there was no signifcant change in enzyme activity when PfInGPS was incubated with guanidine hydrochloride at or below 5 M. However, the enzyme activity drastically decreased above 5 M guanidine hydrochloride (data not shown). This may be attributed to the fact that guanidine hydrochloride is a denaturant as well as a charged molecule; whereas urea is an uncharged molecule, hence defcient in ionic strength efects.
Kinetic parameters
For kinetic studies, various concentrations of the substrate (CdRP), ranging from 0.01 to 10 mM, and fxed amount of PfInGPS were used. Kinetic parameters were calculated from the Michaelis–Menten plot of the substrate concentrations and the velocities (Fig. 3e). The enzyme exhibited apparent Km and Vmax values of 140 ± 10 μM and 20±0.5 μmol min−1 mg−1, respectively. The apparent Km value is quite higher than the corresponding values of 85 and 105 nM at 25 and 60 °C, respectively, reported for the counterpart enzyme from Sulfolobus solfataricus (Schlee et al. 2018). However, these values are not very much distinct from the corresponding enzymes from bacteria and eukaryotes (Gerth et al. 2012; Prantl et al. 1985). A comparison of the kinetic parameters exhibited by InGPS from various organisms, along with the assay temperature, is shown in Table 3. Literature shows that the Km values vary with the change in assay temperature (Merz et al. 1999; Zaccardi et al. 2012). Therefore, any inference cannot be concluded.
PfInGPS exhibited a kcat value of 8.4 s−1 which is higher than its several counterparts (Table 3). The activation energy for the reaction catalyzed by PfInGPS, calculated from the Arrhenius plot (Fig. 3f), was 17±0.5 kJ mol−1. Activation (Fig. 3g), were 18±0.5 kJ mol−1 and −174±1 J mol−1 K−1, respectively.
Conclusion
The results obtained in this study demonstrate that PfInGPS is highly resistant to temperature and protein denaturants. The results demonstrate that it is the most thermostable InGPS characterized to date. Further studies are needed to elucidate its role in P. furiosus.
EthylenediamineCatalog No.:AA003QG3 CAS No.:107-15-3 MDL No.:MFCD00008204 MF:C2H8N2 MW:60.0983 |
GlycolonitrileCatalog No.:AA007TBY CAS No.:107-16-4 MDL No.:MFCD00042731 MF:C2H3NO MW:57.0513 |
2-Propen-1-olCatalog No.:AA007T66 CAS No.:107-18-6 MDL No.:MFCD00002920 MF:C3H6O MW:58.0791 |
Propargyl alcoholCatalog No.:AA003TW6 CAS No.:107-19-7 MDL No.:MFCD00002912 MF:C3H4O MW:56.0633 |
2-ChloroacetaldehydeCatalog No.:AA00388U CAS No.:107-20-0 MDL No.:MFCD00006992 MF:C2H3ClO MW:78.4976 |
Ethylene glycolCatalog No.:AA0035S5 CAS No.:107-21-1 MDL No.:MFCD00002885 MF:C2H6O2 MW:62.0678 |
Glyoxal, 40% solution in waterCatalog No.:AA007T5N CAS No.:107-22-2 MDL No.:MFCD00006957 MF:C2H2O2 MW:58.0361 |
ETHYLMERCURIC CHLORIDECatalog No.:AA008YTN CAS No.:107-27-7 MDL No.:MFCD00013593 MF:C2H5ClHg MW:265.1041 |
AcetaldoximeCatalog No.:AA003NJL CAS No.:107-29-9 MDL No.:MFCD00002124 MF:C2H5NO MW:59.0672 |
Methyl formateCatalog No.:AA003561 CAS No.:107-31-3 MDL No.:MFCD00003291 MF:C2H4O2 MW:60.0520 |
2-aminoethane-1-sulfonic acidCatalog No.:AA0035JX CAS No.:107-35-7 MDL No.:MFCD00008197 MF:C2H7NO3S MW:125.1469 |
2-Hydroxyethanesulphonic acidCatalog No.:AA00339Z CAS No.:107-36-8 MDL No.:MFCD00242599 MF:C2H6O4S MW:126.1316 |
ALLYLTRICHLOROSILANECatalog No.:AA003NNV CAS No.:107-37-9 MDL No.:MFCD00000486 MF:C3H5Cl3Si MW:175.5163 |
2-Methyl-2,4-pentanediolCatalog No.:AA0033B3 CAS No.:107-41-5 MDL No.:MFCD00004547 MF:C6H14O2 MW:118.1742 |
BetaineCatalog No.:AA00HATM CAS No.:107-43-7 MDL No.:MFCD00012123 MF:C5H11NO2 MW:117.1463 |
Tert-OctylamineCatalog No.:AA007EEA CAS No.:107-45-9 MDL No.:MFCD00008053 MF:C8H19N MW:129.2432 |
HexamethyldisiloxaneCatalog No.:AA003QTW CAS No.:107-46-0 MDL No.:MFCD00008265 MF:C6H18OSi2 MW:162.3775 |
tert-Butyl sulfideCatalog No.:AA008SJM CAS No.:107-47-1 MDL No.:MFCD00008839 MF:C8H18S MW:146.2935 |
TetradecamethylcycloheptasiloxaneCatalog No.:AA007EDW CAS No.:107-50-6 MDL No.:MFCD30534308 MF:C14H42O7Si7 MW:519.0776 |
POLY(DIMETHYLSILOXANE), HYDROXY TERMINATEDCatalog No.:AA003TR1 CAS No.:107-51-7 MDL No.:MFCD00008264 MF:C8H24O2Si3 MW:236.5315 |
TetradecamethylhexasiloxaneCatalog No.:AA003UKR CAS No.:107-52-8 MDL No.:MFCD08275354 MF:C14H42O5Si6 MW:458.9933 |
3,5-Dimethylhex-1-yn-3-olCatalog No.:AA003ILM CAS No.:107-54-0 MDL No.:MFCD00008941 MF:C8H14O MW:126.1962 |
N-tert-ButylacrylamideCatalog No.:AA003TAE CAS No.:107-58-4 MDL No.:MFCD00026271 MF:C7H13NO MW:127.1842 |
Tert-Butyl 2-chloroacetateCatalog No.:AA003UGM CAS No.:107-59-5 MDL No.:MFCD00000930 MF:C6H11ClO2 MW:150.6033 |
1,4-Thioxane-1,1-dioxideCatalog No.:AA0032KF CAS No.:107-61-9 MDL No.:MFCD00011683 MF:C4H8O3S MW:136.1695 |
N,N-Dimethyl-N-octadecyloctadecan-1-aminium chlorideCatalog No.:AA0034P4 CAS No.:107-64-2 MDL No.:MFCD00055540 MF:C38H80ClN MW:586.5015 |
Dibutyl phosphateCatalog No.:AA003P9G CAS No.:107-66-4 MDL No.:MFCD00015245 MF:C8H19O4P MW:210.2078 |
N-MethyltaurineCatalog No.:AA0037XF CAS No.:107-68-6 MDL No.:MFCD00014735 MF:C3H9NO3S MW:139.1735 |
Ethanol,2,2,2-trichloro-, 1-carbamateCatalog No.:AA007VPW CAS No.:107-69-7 MDL No.:MFCD01738999 MF:C3H4Cl3NO2 MW:192.4284 |
PentyltrichlorosilaneCatalog No.:AA008484 CAS No.:107-72-2 MDL No.:MFCD00000487 MF:C5H11Cl3Si MW:205.5853 |
Trimethyl-(2-Phosphonooxyethyl)Azanium ChlorideCatalog No.:AA0039EL CAS No.:107-73-3 MDL No.:MFCD00871728 MF:C5H15ClNO4P MW:219.6037 |
1,7-Octanediol, 3,7-dimethyl-Catalog No.:AA00105T CAS No.:107-74-4 MDL No.:MFCD00046005 MF:C10H22O2 MW:174.2805 |
HydroxycitronellalCatalog No.:AA003IO7 CAS No.:107-75-5 MDL No.:MFCD00014681 MF:C10H20O2 MW:172.2646 |
1,3-DibromobutaneCatalog No.:AA007VIB CAS No.:107-80-2 MDL No.:MFCD00000152 MF:C4H8Br2 MW:215.9143 |
2-BromopentaneCatalog No.:AA003B3V CAS No.:107-81-3 MDL No.:MFCD00000160 MF:C5H11Br MW:151.0448 |
1-Bromo-3-methylbutaneCatalog No.:AA003E1K CAS No.:107-82-4 MDL No.:MFCD00000253 MF:C5H11Br MW:151.0448 |
2-MethylpentaneCatalog No.:AA003HNB CAS No.:107-83-5 MDL No.:MFCD00009406 MF:C6H14 MW:86.1754 |
1-Chloro-3-methylbutaneCatalog No.:AA003E57 CAS No.:107-84-6 MDL No.:MFCD00013693 MF:C5H11Cl MW:106.5938 |
IsoamylamineCatalog No.:AA0034Z8 CAS No.:107-85-7 MDL No.:MFCD00008203 MF:C5H13N MW:87.1634 |
3-Methyl-2-butenalCatalog No.:AA0033O9 CAS No.:107-86-8 MDL No.:MFCD00010291 MF:C5H8O MW:84.1164 |
2-PentanoneCatalog No.:AA003861 CAS No.:107-87-9 MDL No.:MFCD00009400 MF:C5H10O MW:86.1323 |
1,3-ButanediolCatalog No.:AA003BB7 CAS No.:107-88-0 MDL No.:MFCD00004554 MF:C4H10O2 MW:90.1210 |
2-CyanoacetamideCatalog No.:AA003376 CAS No.:107-91-5 MDL No.:MFCD00008024 MF:C3H4N2O MW:84.0767 |
Butyric acidCatalog No.:AA0037XE CAS No.:107-92-6 MDL No.:MFCD00002814 MF:C4H8O2 MW:88.1051 |
Crotonic acidCatalog No.:AA0034K5 CAS No.:107-93-7 MDL No.:MFCD00002701 MF:C4H6O2 MW:86.0892 |
3-Chloropropionic acidCatalog No.:AA003J8L CAS No.:107-94-8 MDL No.:MFCD00002764 MF:C3H5ClO2 MW:108.5236 |
Beta-alanineCatalog No.:AA0035QI CAS No.:107-95-9 MDL No.:MFCD00008200 MF:C3H7NO2 MW:89.0932 |
3-Mercaptopropanoic acidCatalog No.:AA0033NX CAS No.:107-96-0 MDL No.:MFCD00004897 MF:C3H6O2S MW:106.1435 |
SarcosineCatalog No.:AA003U4J CAS No.:107-97-1 MDL No.:MFCD00004279 MF:C3H7NO2 MW:89.0932 |
1-Methoxy-2-propanolCatalog No.:AA0032PT CAS No.:107-98-2 MDL No.:MFCD00004537 MF:C4H10O2 MW:90.1210 |
Tri-n-octylaluminumCatalog No.:AA0082O0 CAS No.:1070-00-4 MDL No.:MFCD00040497 MF:C24H51Al MW:366.6433 |
Tri-n-decylamineCatalog No.:AA003V29 CAS No.:1070-01-5 MDL No.:MFCD00041914 MF:C30H63N MW:437.8279 |
Titanium ethylhexoxideCatalog No.:AA008R0J CAS No.:1070-10-6 MDL No.:MFCD00015264 MF:C8H18OTi MW:178.0949 |
(2S,2'S)-2,2'-(Ethane-1,2-diylbis(azanediyl))bis(butan-1-ol) dihydrochlorideCatalog No.:AA008QXY CAS No.:1070-11-7 MDL No.:MFCD21364080 MF:C10H26Cl2N2O2 MW:277.2316 |
Mono-ethyl succinateCatalog No.:AA003571 CAS No.:1070-34-4 MDL No.:MFCD00053346 MF:C6H10O4 MW:146.1412 |
Ethyl hydrogen glutarateCatalog No.:AA003QCI CAS No.:1070-62-8 MDL No.:MFCD00014379 MF:C7H12O4 MW:160.1678 |
Ethyl 6,8-dichlorooctanoateCatalog No.:AA003MYS CAS No.:1070-64-0 MDL No.:MFCD01711127 MF:C10H18Cl2O2 MW:241.1547 |
1,4-Butanediol diacrylateCatalog No.:AA003DKG CAS No.:1070-70-8 MDL No.:MFCD00014940 MF:C10H14O4 MW:198.2158 |
1,1,1,3-Tetrachloro-PropaneCatalog No.:AA003AWJ CAS No.:1070-78-6 MDL No.:MFCD00054655 MF:C3H4Cl4 MW:181.8759 |
3,3-Dimethylbutyric acidCatalog No.:AA003IAO CAS No.:1070-83-3 MDL No.:MFCD00002715 MF:C6H12O2 MW:116.1583 |
Sodium bis(trimethylsilyl)amideCatalog No.:AA0035IL CAS No.:1070-89-9 MDL No.:MFCD00009835 MF:C6H18NNaSi2 MW:183.3746 |
GRANISETRON IMPURITY BCatalog No.:AA008WZ3 CAS No.:107007-95-4 MDL No.:MFCD00872014 MF:C17H22N4O MW:298.3828 |
1-Methyl-1h-indazole-3-carboxylic acid (9-methyl-9-aza-bicyclo[3.3.1]non-3-yl)-amide hydrochlorideCatalog No.:AA008YXN CAS No.:107007-99-8 MDL No.:MFCD01747034 MF:C18H25ClN4O MW:348.8703 |
H-VAL-HIS-HIS-GLN-LYS-LEU-VAL-PHE-PHE-ALA-GLU-ASP-VAL-GLY-SER-ASN-LYS-OHCatalog No.:AA008RQO CAS No.:107015-83-8 MDL No.:MFCD00133075 MF:C98H153N25O25 MW:2081.4159 |
1-Amino-cyclopropanemethanolCatalog No.:AA007BA1 CAS No.:107017-72-1 MDL No.:MFCD01318221 MF:C4H9NO MW:87.1204 |
tert-Butyl 1-(hydroxymethyl)cyclopropylcarbamateCatalog No.:AA00359O CAS No.:107017-73-2 MDL No.:MFCD09749954 MF:C9H17NO3 MW:187.2362 |
1-cyclohexyl-2,2,2-trifluoroethan-1-olCatalog No.:AA01A3YJ CAS No.:107018-38-2 MDL No.:MFCD16067889 MF:C8H13F3O MW:182.1834 |
(S)-N-Boc-azetidine-2-carboxylic acid methyl esterCatalog No.:AA00385I CAS No.:107020-12-2 MDL No.:MFCD09025329 MF:C10H17NO4 MW:215.2463 |
N-Acetyl-dl-cyclohexylglycineCatalog No.:AA008R87 CAS No.:107020-80-4 MDL No.:MFCD11046379 MF:C10H17NO3 MW:199.2469 |
Methanone,[4-(4-amino-6,7-dimethoxy-2-quinazolinyl)-1-piperazinyl]bicyclo[2.2.2]octa-2,5-dien-2-yl-Catalog No.:AA007B9Z CAS No.:107021-36-3 MDL No.:MFCD00213548 MF:C23H27N5O3 MW:421.4922 |
5-Bromo-4-chloro-3-indolyl-alpha-d-galactopyranosideCatalog No.:AA007B9X CAS No.:107021-38-5 MDL No.:MFCD00063780 MF:C14H15BrClNO6 MW:408.6290 |
4-(tert-butyl)-6-chloro-1,3,5-triazin-2-amineCatalog No.:AA01BRPP CAS No.:1070217-24-1 MDL No.:MFCD24642812 MF:C7H11ClN4 MW:186.6420 |
6-tert-butyl-2-chloropyrimidin-4-amineCatalog No.:AA01BRYJ CAS No.:1070217-28-5 MDL No.:MFCD21100172 MF:C8H12ClN3 MW:185.6540 |
2-tert-butyl-6-chloropyrimidin-4-amineCatalog No.:AA01B8B3 CAS No.:1070217-33-2 MDL No.:MFCD24019063 MF:C8H12ClN3 MW:185.6540 |
N-Cyanomethyl-n-methyl-4-nitroanilineCatalog No.:AA003STS CAS No.:107023-66-5 MDL No.:MFCD00191337 MF:C9H9N3O2 MW:191.1867 |
tert-butyl 2-(4-fluorophenyl)-2-oxoacetateCatalog No.:AA01E8C2 CAS No.:1070237-29-4 MDL No.:MFCD30733991 MF:C12H13FO3 MW:224.2282 |
8-Methyl-2-phenylquinoline-4-carboxylic acidCatalog No.:AA007B9V CAS No.:107027-34-9 MDL No.:MFCD00487551 MF:C17H13NO2 MW:263.2906 |
8-Methyl-2-pyridin-2-ylquinoline-4-carboxylic acidCatalog No.:AA007TG0 CAS No.:107027-35-0 MDL No.:MFCD03421963 MF:C16H12N2O2 MW:264.2787 |
2-(2-Chlorophenyl)-8-methylquinoline-4-carboxylic acidCatalog No.:AA008VJE CAS No.:107027-38-3 MDL No.:MFCD03420032 MF:C17H12ClNO2 MW:297.7357 |
8-Methyl-2-pyridin-3-ylquinoline-4-carboxylic acidCatalog No.:AA007B9U CAS No.:107027-39-4 MDL No.:MFCD03421957 MF:C16H12N2O2 MW:264.2787 |
2-(3-Methoxyphenyl)-8-methylquinoline-4-carboxylic acidCatalog No.:AA008VBK CAS No.:107027-41-8 MDL No.:MFCD03075217 MF:C18H15NO3 MW:293.3166 |
8-Methyl-2-pyridin-4-ylquinoline-4-carboxylic acidCatalog No.:AA008V3M CAS No.:107027-42-9 MDL No.:MFCD03421951 MF:C16H12N2O2 MW:264.2787 |
2-(4-Chlorophenyl)-8-methylquinoline-4-carboxylic acidCatalog No.:AA0082NS CAS No.:107027-43-0 MDL No.:MFCD03420033 MF:C17H12ClNO2 MW:297.7357 |
2-(4-Methoxyphenyl)-8-methylquinoline-4-carboxylic acidCatalog No.:AA008VJI CAS No.:107027-47-4 MDL No.:MFCD03420036 MF:C18H15NO3 MW:293.3166 |
tert-butyl (3S,5R)-5-(hydroxymethyl)pyrrolidin-3-ylcarbamateCatalog No.:AA008R98 CAS No.:1070295-74-7 MDL No.:MFCD08704538 MF:C10H20N2O3 MW:216.2774 |
2',3'-dideoxy-5-methylcytidineCatalog No.:AA008YJR CAS No.:107036-56-6 MDL No.:MFCD15145224 MF:C10H15N3O3 MW:225.2444 |
4-((6-Chloro-2-((4-cyanophenyl)amino)pyrimidin-4-yl)oxy)-3,5-dimethylbenzonitrileCatalog No.:AA0082NO CAS No.:1070377-34-2 MDL No.:MFCD22421649 MF:C20H14ClN5O MW:375.8111 |
2,2,2-Trifluoro-1-pyridin-2-ylethanolCatalog No.:AA0020Z4 CAS No.:107040-75-5 MDL No.:MFCD16618050 MF:C7H6F3NO MW:177.1238 |
tert-Butyl 4-(aminomethyl)benzoateCatalog No.:AA0082NN CAS No.:107045-28-3 MDL No.:MFCD04973451 MF:C12H17NO2 MW:207.2689 |
1-[4-[4-(2,4-DI-TERT-PENTYLPHENOXY)-BUTYRAMIDO]-PHENYL]3-PYRROLIDINO-4-(1-PHENYL-TETRAZOL-5-YL)-THIO-PYRAZOLIN-5-ONECatalog No.:AA008UX7 CAS No.:107047-27-8 MDL No.:MFCD00308850 MF:C40H50N8O3S MW:722.9418 |
2,4-Dichloro-6-(trifluoromethyl)phenylhydrazineCatalog No.:AA007B9L CAS No.:107047-29-0 MDL No.:MFCD00174090 MF:C7H5Cl2F3N2 MW:245.0292 |
5-phenyl-5H-indeno[1,2-b]pyridin-5-olCatalog No.:AA00IPNB CAS No.:107053-09-8 MDL No.:MFCD00618669 MF:C18H13NO MW:259.3019 |
5-Hydroxy-3,4,7-trimethyl-2H-chromen-2-oneCatalog No.:AA007TFR CAS No.:107057-96-5 MDL No.:MFCD03713196 MF:C12H12O3 MW:204.2219 |
N-EthylcarbaMic Acid 3-[(1S)-1-(DiMethylaMino)ethyl]phenyl EsterCatalog No.:AA008WG9 CAS No.:1070660-34-2 MDL No.:MFCD29076980 MF:C13H20N2O2 MW:236.3101 |
rac-(3R,5R)-1-[(tert-butoxy)carbonyl]-5-phenylpiperidine-3-carboxylic acid, cisCatalog No.:AA01EKOR CAS No.:1070661-25-4 MDL No.:MFCD31617863 MF:C17H23NO4 MW:305.3688 |
BrettphosCatalog No.:AA0032SN CAS No.:1070663-78-3 MDL No.:MFCD11973797 MF:C35H53O2P MW:536.7679 |
2-Chloro-1-[4-(trifluoromethyl)phenyl]ethan-1-olCatalog No.:AA01BBTO CAS No.:1070686-96-2 MDL No.:MFCD24346510 MF:C9H8ClF3O MW:224.6074 |
4-(Dimethylamino)-2-hydroxyacetophenoneCatalog No.:AA009OCH CAS No.:107070-69-9 MDL No.:MFCD11870193 MF:C10H13NO2 MW:179.2157 |
tert-Butyl 4-(4-chlorophenyl)piperazine-1-carboxylateCatalog No.:AA0096RE CAS No.:1070716-32-3 MDL No.:MFCD11872564 MF:C15H21ClN2O2 MW:296.7924 |
3-(Pyrrol-1-yl)thiophene-2-methanolCatalog No.:AA008SF5 CAS No.:107073-27-8 MDL No.:MFCD00052578 MF:C9H9NOS MW:179.2389 |
3-fluoro-2-methyl-4-(trifluoromethyl)benzoic acidCatalog No.:AA01AC95 CAS No.:1070761-76-0 MDL No.:MFCD27980628 MF:C9H6F4O2 MW:222.1364 |
rac trans-2-Phenylcyclopropylamine-d5 HydrochlorideCatalog No.:AA003U1A CAS No.:107077-98-5 MDL No.:MFCD08063537 MF:C9H12ClN MW:169.6513 |
(2S)-2,4-DIMETHYLPENT-4-ENOIC ACIDCatalog No.:AA01DUVH CAS No.:1070774-52-5 MDL No.:MFCD19229301 MF:C7H12O2 MW:128.1690 |
DMAPTCatalog No.:AA0097CN CAS No.:1070780-82-3 MDL No.: MF: MW: |
CYC065Catalog No.:AA01EONG CAS No.:1070790-89-4 MDL No.:MFCD21496424 MF:C21H31N7O MW:397.5171 |
5-Bromo-2-ethoxyanisoleCatalog No.:AA00HATP CAS No.:1070795-38-8 MDL No.:MFCD15526975 MF:C9H11BrO2 MW:231.0864 |
1,2-Bis[1,3-bis(2,6-di-i-propylphenyl)iMidazol-2-ylidene]disileneCatalog No.:AA008WIQ CAS No.:1070876-63-9 MDL No.:MFCD22666025 MF:C54H72N4Si2 MW:833.3473 |
Methyl 2-((benzyloxycarbonylamino)methyl)-1h-imidazole-5-carboxylateCatalog No.:AA007B3N CAS No.:1070879-22-9 MDL No.:MFCD11052867 MF:C14H15N3O4 MW:289.2866 |
4-Bromo-6-methylquinolineCatalog No.:AA008UB9 CAS No.:1070879-23-0 MDL No.:MFCD11505108 MF:C10H8BrN MW:222.0812 |
4-Bromo-7-methylquinolineCatalog No.:AA007B3M CAS No.:1070879-24-1 MDL No.:MFCD08063191 MF:C10H8BrN MW:222.0812 |
4-Bromo-7-methoxyquinolineCatalog No.:AA003KWH CAS No.:1070879-27-4 MDL No.:MFCD08063187 MF:C10H8BrNO MW:238.0806 |
4-Bromo-7-fluoroquinolineCatalog No.:AA008UBA CAS No.:1070879-29-6 MDL No.:MFCD08063190 MF:C9H5BrFN MW:226.0451 |
4-Bromo-6-chloroquinolineCatalog No.:AA008SJK CAS No.:1070879-30-9 MDL No.:MFCD11505112 MF:C9H5BrClN MW:242.4997 |
4,8-DibromoquinolineCatalog No.:AA008SJL CAS No.:1070879-31-0 MDL No.:MFCD08063207 MF:C9H5Br2N MW:286.9507 |
4-bromo-6-(trifluoromethyl)quinolineCatalog No.:AA0082J5 CAS No.:1070879-32-1 MDL No.:MFCD11505113 MF:C10H5BrF3N MW:276.0526 |
4-Bromo-5,7-dimethylquinolineCatalog No.:AA007B3L CAS No.:1070879-33-2 MDL No.:MFCD11505114 MF:C11H10BrN MW:236.1078 |
4-Bromo-5,8-dichloroquinolineCatalog No.:AA007B3K CAS No.:1070879-38-7 MDL No.:MFCD11505120 MF:C9H4BrCl2N MW:276.9448 |
4-Bromo-7,8-dichloroquinolineCatalog No.:AA007TD2 CAS No.:1070879-40-1 MDL No.:MFCD11505123 MF:C9H4BrCl2N MW:276.9448 |
4-Bromo-7-chloro-8-methylquinolineCatalog No.:AA003KWE CAS No.:1070879-42-3 MDL No.:MFCD11505125 MF:C10H7BrClN MW:256.5263 |
4-Bromo-6-ethyl-2-methylquinolineCatalog No.:AA007B3J CAS No.:1070879-44-5 MDL No.:MFCD11505128 MF:C12H12BrN MW:250.1344 |
4-Bromo-6-ethoxy-2-methylquinolineCatalog No.:AA0093BJ CAS No.:1070879-46-7 MDL No.:MFCD11505131 MF:C12H12BrNO MW:266.1338 |
4-Bromo-6-fluoro-2-methylquinolineCatalog No.:AA0082J4 CAS No.:1070879-47-8 MDL No.:MFCD11505132 MF:C10H7BrFN MW:240.0717 |
4-Bromo-8-fluoro-2-methylquinolineCatalog No.:AA0082J3 CAS No.:1070879-49-0 MDL No.:MFCD11505134 MF:C10H7BrFN MW:240.0717 |
4-Bromo-6-chloro-2-methylquinolineCatalog No.:AA007B3I CAS No.:1070879-50-3 MDL No.:MFCD11505135 MF:C10H7BrClN MW:256.5263 |
4,6-Dibromo-2-methylquinolineCatalog No.:AA007B3H CAS No.:1070879-53-6 MDL No.:MFCD09261090 MF:C10H7Br2N MW:300.9773 |
4,8-Dibromo-2-methylquinolineCatalog No.:AA00935V CAS No.:1070879-55-8 MDL No.:MFCD11505139 MF:C10H7Br2N MW:300.9773 |
4-Bromo-2-methyl-8-trifluoromethylquinolineCatalog No.:AA007B3G CAS No.:1070879-58-1 MDL No.:MFCD11505142 MF:C11H7BrF3N MW:290.0792 |
4-Bromo-2,6,8-trimethylquinolineCatalog No.:AA007TCW CAS No.:1070879-60-5 MDL No.:MFCD11505145 MF:C12H12BrN MW:250.1344 |
4-Bromo-2,7,8-trimethylquinolineCatalog No.:AA0082J1 CAS No.:1070879-61-6 MDL No.:MFCD11505146 MF:C12H12BrN MW:250.1344 |
4-Bromo-7-chloro-2,8-dimethylquinolineCatalog No.:AA003KWD CAS No.:1070879-69-4 MDL No.:MFCD11504910 MF:C11H9BrClN MW:270.5529 |
4-Hydroxy-8-methyl-2-propylquinolineCatalog No.:AA007B3B CAS No.:1070879-87-6 MDL No.:MFCD11505250 MF:C13H15NO MW:201.2643 |
4-Hydroxy-7-methoxy-2-propylquinolineCatalog No.:AA007B3A CAS No.:1070879-90-1 MDL No.:MFCD11505253 MF:C13H15NO2 MW:217.2637 |
5-Bromo-2-(trifluoromethyl)isonicotinonitrileCatalog No.:AA007B33 CAS No.:1070892-04-4 MDL No.:MFCD18261445 MF:C7H2BrF3N2 MW:251.0034 |
N-(3-Fluoro-2-chloro-phenyl)-formamideCatalog No.:AA0082IW CAS No.:1070892-66-8 MDL No.:MFCD19441850 MF:C7H5ClFNO MW:173.5721 |
methyl 4-chloro-2-methoxy-5-(tetramethyl-1,3,2-dioxaborolan-2-yl)benzoateCatalog No.:AA0093HJ CAS No.:1070892-90-8 MDL No.:MFCD19441823 MF:C15H20BClO5 MW:326.5803 |
(4,6-Dichloropyridin-3-yl)boronic acidCatalog No.:AA008UOR CAS No.:1070893-11-6 MDL No.:MFCD06657879 MF:C5H4BCl2NO2 MW:191.8078 |
4-Chloro-2-fluoro-5-nitro-benzoic acid methyl esterCatalog No.:AA0095P6 CAS No.:1070893-15-0 MDL No.:MFCD12172989 MF:C8H5ClFNO4 MW:233.5810 |
3-Fluoro-4-piperidinone, HClCatalog No.:AA003JDQ CAS No.:1070896-59-1 MDL No.:MFCD11506659 MF:C5H9ClFNO MW:153.5825 |
Thiazole OrangeCatalog No.:AA007B32 CAS No.:107091-89-4 MDL No.:MFCD00192499 MF:C26H24N2O3S2 MW:476.6104 |
N-Methyl-4-nitrobenzo[c][1,2,5]selenadiazol-5-amineCatalog No.:AA007TCJ CAS No.:107095-01-2 MDL No.:MFCD07369496 MF:C7H6N4O2Se MW:257.1081 |
2-(3-Phenyl-4Catalog No.:AA01FOG8 CAS No.:107095-39-6 MDL No.:MFCD00489351 MF:C15H14N2O MW:238.2845 |
3-(2-{[(tert-butoxy)carbonyl]amino}phenyl)propanoic acidCatalog No.:AA01BG1Q CAS No.:1070955-54-2 MDL No.:MFCD24465890 MF:C14H19NO4 MW:265.3050 |
2-Methyl-6-nitrobenzaldehydeCatalog No.:AA009T9F CAS No.:107096-52-6 MDL No.:MFCD10696870 MF:C8H7NO3 MW:165.1461 |
(S)-tert-Butyl (pyrrolidin-2-ylmethyl)carbamate hydrochlorideCatalog No.:AA008Y9P CAS No.:1070968-08-9 MDL No.:MFCD11101393 MF:C10H21ClN2O2 MW:236.7389 |
N-Methyl-5-phenyl-1,3,4-thiadiazol-2-amine hydrochlorideCatalog No.:AA019SWP CAS No.:107097-06-3 MDL No.:MFCD20731177 MF:C9H10ClN3S MW:227.7138 |
1-(Cyclopent-1-en-1-yl)-1H-1,2,3-benzotriazoleCatalog No.:AA01EQM9 CAS No.:107097-16-5 MDL No.:MFCD00966480 MF:C11H11N3 MW:185.2251 |
LOXIGLUMIDECatalog No.:AA008RYY CAS No.:107097-80-3 MDL No.:MFCD00866772 MF:C21H30Cl2N2O5 MW:461.3793 |
5-Bromo-4-chloro-2-fluoro-benzenesulfonyl chlorideCatalog No.:AA0091PY CAS No.:1070972-67-6 MDL No.:MFCD19441846 MF:C6H2BrCl2FO2S MW:307.9523 |
2-Amino-3-chloro-5-iodo-benzoic acid methyl esterCatalog No.:AA01FR37 CAS No.:1070977-94-4 MDL No.:MFCD31672754 MF:C8H7ClINO2 MW:311.5042 |
methyl 2-{[(tert-butoxy)carbonyl]amino}-5-(tetramethyl-1,3,2-dioxaborolan-2-yl)benzoateCatalog No.:AA01B9M8 CAS No.:1070979-39-3 MDL No.:MFCD23379520 MF:C19H28BNO6 MW:377.2397 |
2,5-Dimethoxyphenylboronic acidCatalog No.:AA003FWC CAS No.:107099-99-0 MDL No.:MFCD01318181 MF:C8H11BO4 MW:181.9815 |
Butanenitrile,4,4'-(dichlorosilylene)bis-Catalog No.:AA007B2X CAS No.:1071-17-6 MDL No.:MFCD00039499 MF:C8H12Cl2N2Si MW:235.1858 |
Propanenitrile,3-(dichloromethylsilyl)-Catalog No.:AA007TCA CAS No.:1071-21-2 MDL No.:MFCD00013819 MF:C4H7Cl2NSi MW:168.0966 |
2-CYANOETHYLTRICHLOROSILANECatalog No.:AA003H1L CAS No.:1071-22-3 MDL No.:MFCD00039493 MF:C3H4Cl3NSi MW:188.5151 |
