Mechanisms of tissue factor induction by the uremic toxin indole-3  acetic acid through aryl hydrocarbon receptor/nuclear factor-kappa B  signaling pathway in human endothelial cells

Tawfik Addi1,2 · Stéphane Poitevin1 · Nathalie McKay1 · Kamel Eddine El Mecherfi2,3 · Omar Kheroua2 · Noémie Jourde‑Chiche1,4 · Alix de Macedo5 · Bertrand Gondouin6 · Claire Cerini1 · Philippe Brunet1,4 · Françoise Dignat‑George1 · Stéphane Burtey1,4 · Laetitia Dou1

Cardiovascular disease (CVD) is the leading cause of death  in patients with chronic kidney disease (CKD) (Go et al. 2004; Tonelli et al. 2006). Thrombosis is a key event in CVD; and CKD is associated with an increased thrombotic risk (Daneschvar et al. 2008; Wattanakit and Cushman 2009; Carney 2016). In patients with CKD, the balance of the coagulation system is dysregulated, with higher levels of factor VII,  factor VIII, thrombin and tissue factor (TF) (Jalal et al. 2010; Huang et al. 2017). Accumulation of some uremic toxins normally eliminated by the kidney is correlated with CVD and mortality in patients with CKD (Barreto et al. 2009; Moradi et al. 2013; Han et al. 2015; Storino et al. 2015). The uremic toxin indole-3 acetic acid (IAA) is an independent predictor of cardiovascular events and mortality in patients with CKD (Dou et al. 2015). IAA is a uremic indolic toxin derived from the metabolization of dietary tryptophan by the gut microbiota (Fernandez-Prado et al. 2017). Because of its proteinbinding (Jourde-Chiche et al. 2009), IAA is poorly removed by dialysis (Neirynck et al. 2013). In cultured endothelial cells, IAA promotes the expression of a proinflammatory phenotype (Gondouin et al. 2013; Dou et al. 2015). IAA also increases the endothelial expression and procoagulant activity of TF (Gondouin et al. 2013), the principal initiator of blood coagulation (Camerer et al. 1996). Tissue factor expression is induced by various stimuli, such as pro-inflammatory cytokines, lipopolysaccharides (LPS), growth factors, or thromboxane A2, via different transcription factors: NF-κB, AP-1, NFAT or Egr-1 (Bode and Mackman 2014). Interestingly, we have described that indolic toxins induce TF expression by a new pathway: the aryl hydrocarbon receptor (AhR) pathway (Gondouin et al. 2013). AhR was initially described as a receptor of some environmental contaminants, especially 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) (Hankinson 1995; Mandal 2005); and IAA is an endogenous agonist of AhR (Heath-Pagliuso et al. 1998).

In resting cells, AhR forms a complex with HSP90, XAP2 and p23 in the cytoplasm (Heid et al. 2000; Petrulis and Perdew 2002). After ligand binding to AhR, the complex dissociates, resulting in AhR translocation into the nucleus and dimerization with the aryl hydrocarbon nuclear translocator (ARNT).  The AHR/ARNT heterodimer binds to the XRE (Xenobiotic Response Element) sequences on the promoters of AhR target genes such as CYP1A1, CYP1A2, or CYP1B1 (Dolwick et al. 1993; Fujii-Kuriyama and Mimura 2005). In addition to this direct genomic pathway, a non-genomic inflammatory AhR 
pathway, independent of ARNT, has been described (Zhao et al. 2002; Sciullo et al. 2008; Matsumura 2009; Kim et al. 2012). AhR ligands, such as TCDD, induce the expression of proteins involved in inflammation such as IL-6, RANTES, TNF, and COX-2 (Zhao et al. 2002; Sciullo et al. 2008; Matsumura 2009; Kim et al. 2012). In the non-genomic pathway, AhR acts as a signaling molecules that interacts with multiple signaling pathways (Borlak and Jenke 2008; Henklová et al. 2008; Ma et al. 2009; Puga et al. 2009a). We recently reported that a non-genomic pathway of AhR involving p38MAPK/NF-κB signaling is crucial for the induction of endothelial COX-2 by IAA (Dou et al. 2015).

Until now, the mechanisms through which AhR controls TF expression in endothelial cells were poorly understood. The objective of the present work was, therefore, to determine the signaling pathways and the transcriptions factors involved in AhR-mediated TF induction by IAA.

Methods Endothelial cell culture
HUVEC were obtained from umbilical cord vein by collagenase digestion as described (Jaffe et al. 1973) and grown to the fourth passage in EGM-2 medium (Lonza, France) (containing 2% fetal bovine serum), under standard cell culture conditions (humidified atmosphere at 37 °C, 5% CO2). Human aortic endothelial cells (HAoEC) and cardiacderived microvascular endothelial cells (HMVEC-C) were 
obtained from Lonza. HMVEC-C were grown to the fifth passages in EGM-2 MV medium (Lonza, France) (containing 5% fetal bovine serum) under standard cell culture conditions. HAoEC were grown to the fifth passage in EGM-2 medium under standard cell culture conditions.

Effect of the uremic toxin IAA
Cells were incubated in the presence of IAA (Sigma-Aldrich, France) at 50 µM, the highest concentration described in uremic patients (Vanholder et al. 2003). They were treated during indicated times, with or without the AhR Inhibitor CH-229131 at 10 µM (Sigma-Aldrich), the NF-κB inhibitor BAY 11-7082 at 10 µM (Merck Chemicals), the PKC inhibitor Bisindolymaleimide I at 5 µM (Merck Chemicals), the p38 inhibitor SB203580 at 10 µM (Sigma-Aldrich), the ERK1/2 inhibitor PD98059 at 10 µM (Sigma-Aldrich), and the transcription inhibitor Actinomycin D at 1 µg/ml (Sigma-Aldrich). Because IAA was diluted in ethanol, ethanol 1/1000 was used as control. In some experiments, human serum albumin (LFB, France) was added in the culture medium, at the concentration found in human serum (4 g/dL).

SiRNA knockdown of AhR
HUVEC were transfected with siRNA control (Negative Universal Control, Stealth™ RNAi, Life Technologies, France) or a pool containing three Silencer® Select siRNA directed against AhR (1200, 1999 and 1998, Life Technologies, France) by magnetofection using SilenceMag beads (OZ Biosciences, France), according to the manufacturer’s instructions. The knockdown of AhR was verified by western blot on cell extracts 48 h after transfection (Supplemental Fig. 1). TF induction and p50 nuclear translocation were determined 48 h after transfection.

RNA extraction and quantitative RT‑PCR analysis of mRNA expression
Total RNA was extracted by an RNeasy mini-kit (Qiagen, France). RT was performed on 500 ng of total RNA using the Takara PrimeScript™ RT reagent Kit (Ozyme, Saint Quentin en Yvelines, France) followed by qPCR on 25 ng of cDNA using the Takara SYBR qPCR Premix Ex Taq (Ozyme). We quantified the following target genes: TF, CYP1A1, and CYP1B1. The housekeeping gene HPRTwas used for normalization of the target gene values. The sequences of primers were as follows: TF forward: 5′TGC AGTAGCTCCAACAGTGC3’, TF reverse: 5′GAGTGTATG GGCCAGGAGAA3’; CYP1A1 forward: 5′GACAGATCC CATCTGCCCTA 3′, CYP1A1 reverse: 5′ATAGCACCA TCAGGGGTGAG 3; CYP1B1 forward: 5′ TGATGGACG CCTTTATCCTC 3′, CYP1B1 reverse: 5′ CCACGACCT GATCCAATTCT 3′; HPRT forward: 5′GGATTATACTGC CTGACCAAGGAAAGC 3′, HPRT reverse: 5′ GAGCTA TTGTAATGACCAGTCAACAGG3′.

All PCR reaction efficiencies were determined with MxPro software (Agilent) and were always between 90 and 110%. The fusion curves were analyzed to assess the specificity of detected fluorescence. Fold change of mRNA expression vs. control condition (ethanol) was calculated using the 2−ΔΔCt method. The transcript for the housekeeping gene HPRT was used for data normalization.

Western blotting and densitometry analysis of Western blots
HUVEC were incubated with 50 µM IAA, or with ethanol diluted 1/1000 (vehicle control) during 30 min, with or without the AhR Inhibitor CH-229131 at 10 µM (SigmaAldrich). Some experiments were also performed on HUVECs transfected with AhR siRNA or control siRNA, and cells were stimulated with IAA 50 µM 48 h after transfection. Nuclear extracts were prepared using Cayman Chemical’s Nuclear Extraction Kit (interchim, France). 

Cytosolic extracts were prepared using 1 ml of lysis buffer containing 20 mM MOPS, 50 mM β-glycerolphosphate, 50 mM sodium fluoride, 1 mM sodium orthovanadate, 5 mM EGTA, 2 mM EDTA, 1% NP40, 1 mM dithiothreitol (DTT), 1 mM benzamidine, 1 mM phenylmethanesulphonylfluoride (PMSF) and 10 µg/mL leupeptin and aprotinin. The cells were incubated 10 min on ice and then collected with a scraper. The cytosolic extracts were obtained after centrifugation of cell lysates at 18,000 g for 15 min. Protein concentrations were measured with the Bicinchoninic Acid Kit (BCA1, Sigma-Aldrich).

Samples were mixed with LDS sample buffer and proteins were separated using 4–12% NuPAGE™ protein gel (Life technologies). Proteins were transferred to nitrocellulose membrane and blocked with 5%skim milk for 1 h at room temperature. The membrane was incubated overnight at 4 °C with antibodies directed against AhR (Santa Cruz, France), against NF-kB p50 (Cell Signaling, Ozyme, France), or actin (Cell Signaling, France), and then with the secondary peroxidase-conjugated antibody (Beckman-Coulter, France). Revelations were done by chemiluminescence (ECL Western blotting substrate, Pierce). Gel images were captured using the Syngene GBox (Ozyme) and analyzed with the software geneSys (Ozyme).

Study of NF‑κB and AP‑1 nuclear levels
After HUVEC incubation with 50 µM IAA during 30 min, with or without the AhR Inhibitor CH-229131 at 10 µM (Sigma-Aldrich), the NF-κB inhibitor BAY 11-7082  at 10 µM (Merck Chemicals), the PKC inhibitor Bisindolymaleimide I at 5 µM, the p38 inhibitor SB203580 at 10 µM (Sigma-Aldrich), nuclear extracts were prepared using Cayman Chemical’s Nuclear Extraction Kit (interchim, France). NF-κB p50 was detected in nuclear extracts by Cayman Chemical’s NF-κB (human p50) combo transcription factor assay kit (interchim). This kit is a 96-well ELISA with a specific double stranded DNA sequence containing the NF-KB response element. NF-KB p50 contained in nuclear extracts is detected with a specific primary antibody and a secondary antibody HRP-conjugated that provides a colorimetric 
readout à 450 nm.

Endothelial p65 expression in nuclear extracts was measured after 30 min incubation of HUVEC with IAA 50 µM and detected in nuclear extracts by the Cayman Chemical’s NF-κB (human p50/p65) combo transcription factor assay kit (interchim). AP-1 subunits c-Fos and c-Jun were detected in nuclear extracts by the AP1 (c-Fos/FosB/Fra1/c-Jun/JunB/JunD) transcription factor assay kit (Abcam, Paris, France).
Chromatin immunoprecipitation (ChIP) assay HUVEC monolayers (6×106 cells) were treated with IAA (50 µM) or ethanol (vehicle) for 60 min. Cells were fixed by adding formaldehyde directly to the medium to a final concentration of 1% and incubated for 10 min at room temperature then 40 min at 4 °C. ChIP assay was performed using the EZ-Magna ChIP™ A/G Chromatin Immunoprecipitation Kit (Merck Millipore, France), according to the kit instructions. Immunoprecipitations were performed overnight at 4 °C with 5 µg of rabbit IgG (control IgG) or rabbit polyclonal antibody against AhR (Santa Cruz Biotechnology, Tebu-Bio, France). Real-time PCR quantification of ChIP enrichments was run on a MX3000P instrument (Stratagene) using the Brilliant II SYBR Green QPCR Master Mix (Takara bio, France). Specific primer sequences for promoters were as follows: TF forward, 5′-GCCCTCCCTTTCCTGCCATAGA-3′, TF reverse: 5′-CCTCCCGGTAGGAAACTCCG-3′; CYP1A1 forward: 5′-ACGCAGACCTAGACCCTTTGC-3′, CYP1A1 reverse: 5′-CGGGTGCGCGATTGAA-3′; CYP1B1 forward: 5′-ATATGACTGGAGCCGACTTTCC-3′, CYP1B1 reverse: 5′-GGCGAACTTTATCGGGTTGA-3′. 

Fold enrichment was calculated using the 2− ΔΔCt method, where ΔΔCt represents the difference between threshold cycles of experimental rabbit polyclonal antibodies against AhR over rabbit control IgG.

Transient transfection of HUVEC and Luciferase Promoter Assay
The human TF wild-type promoter (−227 hTF WT), the TF mutant AP-1 (−227 hTF mAP1) and the TF-κB mutant (−227 hTF mTF-κB) reporter plasmids in pGL2 basic were a gift from Nigel Mackman (Addgene plasmid # 15442, 15443, 15444 respectively). HUVEC (1.5×105 cells) were plated into 6-well plates in EGM-2 medium 16 h before transfection. Cells were then incubated 1 h before transfection with Opti-MEM™ reduced-serum medium (Gibco, Life Technologies, France). 

Transfection was performed using Lipofectamine 2000 (Life Technologies, France) associated with magnetofection using CombimagTMbeads (OZ Bioscience, Marseille, France) according to the manufacturer’s instructions. Briefly, reporter plasmids (1 µg) were mixed with 2 µl of Lipofectamine in 200 µl of Opti-MEM reduced serum medium for 20 min then 1 µl of Combimag™ beads was added to DNA-Lipofectamine complexes. The DNA-Lipofectaminebeads complexes were incubated for 20  min at room temperature, incubated with HUVEC for 1 h at 37 °C on a magnetic plate in the 5% CO2 incubator and then replaced with growth medium. After 48 h, HUVEC were treated with IAA or ethanol (vehicle control) for 6 h. Cells were lysed in a reporter lysis buffer and lysates were assayed for lucif-erase activities using the luciferase assay system and the GloMax®-Multi detection system (Promega, France). The pSV-β-Galactosidase control vector (Promega) was cotransfected so that the transfection efficiencies could be normalized with the β-galactosidase activities determined using the b-Glo® assay system (Promega).

Patients
We performed a single center prospective study in 92 hemodialyzed patients, selected according to the following criteria: age>18 years; no cardiovascular event (myocardial infarction, stroke, peripheral vascular disease with amputation or need for angioplasty), infection, or surgical intervention (except for vascular access angioplasty) in the last 3 months; no pregnancy; no recent history of malignancy; no intake of corticosteroids or immunosuppressive agents. Patients had been dialyzed at least 3 times a week for a minimum of 6 months. Patients’ blood samples were drawn before the mid-week hemodialysis session. Blood samples were drawn in BD Vacutainer → tubes containing lithium heparin for biochemical analyses, EDTA for hemoglobin measurement, citrate for TF measurement, and in BD 
Vacutainer → SST tubes for IS, IAA, p-cresylsulfate, and β2-microglobulin measurement. Standard laboratory procedures were used for blood chemistry evaluations. Total IS, IAA, and p-cresylsulfate were measured by HPLC, according to Calaf et al. (2011).

Informed consent was obtained from all individual participants included in the study. The study was approved by the local ethics committee and conforms to the principles outlined in the Declaration of Helsinki.

Measurement of TF by enzyme‑linked immunosorbent assay
TF was quantified in citrated human plasma and in cell lysates of HUVEC with the enzyme-linked immunosorbent assay (ELISA) kit Quantikine Human Coagulation Factor III/Tissue Factor (R&D Systems, Lille, France) according to the instructions of the manufacturer.

Statistical analyses
For in vitro studies, statistical analyses were performed with the Prism (GraphPad Software Inc, CA). Significant differences were revealed by the Wilcoxon signed rank test or by the Mann Whitney test. Data are expressed as mean±SEM of independent experiments performed on different cell preparations.

In CKD patients, data are expressed as mean±standard deviation (SD) for values with normal distribution or median (min; max) for non-normally distributed values. Numerical variables were tested for normality by the Shapiro–Wilk test. 

Correlations between plasma TF and continuous variables were obtained using Spearman correlation coefficients; statistical analyses were performed with the Prism (GraphPad Software Inc, CA) software. To identify factors independently associated with plasma TF, multiple linear regression analyses were performed with the R software. A p value lower than 0.05 was considered significant.

Ethical approval
All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.

AA Blocks offers a comprehensive range of building blocks and specially designed scaffolds to support your R&D like Sigma-Aldrich:

Atipamezole HCl Catalog No.:AA003AUA CAS No.:104075-48-1 MDL No.:MFCD06407819 MF:C14H17ClN2 MW:248.7512	Ethyl 2-(2-methylbenzyl)-3-oxobutanoate Catalog No.:AA00HA7A CAS No.:104075-51-6 MDL No.:MFCD13249391 MF:C14H18O3 MW:234.2909
SKF-95282 dimaleate salt Catalog No.:AA007EZ7 CAS No.:104076-39-3 MDL No.:MFCD01862676 MF:C30H35N3O9S MW:613.6786	2-Chloro-5,6-dimethyl-1,3-benzothiazole Catalog No.:AA009KCY CAS No.:104076-80-4 MDL No.:MFCD09743042 MF:C9H8ClNS MW:197.6845
(+-)-O-METHOXYMANDELIC ACID*DICYCLOHEXYL AMMONIUM Catalog No.:AA009R98 CAS No.:10408-29-4 MDL No.:MFCD00046519 MF:C9H10O4 MW:182.1733	N-Methyl-2,3-dihydro-1h-inden-2-amine hydrochloride Catalog No.:AA008SQ5 CAS No.:10408-85-2 MDL No.:MFCD22666484 MF:C10H14ClN MW:183.6779
Methyl(1-phenylethyl)amine, HCl Catalog No.:AA00389N CAS No.:10408-89-6 MDL No.:MFCD09866174 MF:C9H14ClN MW:171.6672	N-Ethyl-2,3-dihydro-1h-inden-1-amine hydrochloride Catalog No.:AA019WZJ CAS No.:10408-92-1 MDL No.:MFCD13195952 MF:C11H16ClN MW:197.7044
Diethyl 2-((3-(bromomethyl)thiophen-2-yl)methylene)malonate Catalog No.:AA007WOY CAS No.:104085-30-5 MDL No.:MFCD00180836 MF:C13H15BrO4S MW:347.2248	Z-3-DodecenylE-Crotonate Catalog No.:AA01DZCK CAS No.:104086-73-9 MDL No.: MF:C16H28O2 MW:252.3923
1-[2-(piperazin-1-yl)ethyl]imidazolidin-2-one Catalog No.:AA01A87E CAS No.:104087-61-8 MDL No.:MFCD00051428 MF:C9H18N4O MW:198.2654	N-Methyl-n-1,2,3,4-tetrahydronaphthalen-1-ylamine Catalog No.:AA007EOP CAS No.:10409-15-1 MDL No.:MFCD06373941 MF:C11H15N MW:161.2435
2-BROMO-2-METHYLPROPIOPHENONE Catalog No.:AA003GJL CAS No.:10409-54-8 MDL No.:MFCD00000124 MF:C10H11BrO MW:227.0977	2-Quinolinamine, 8-methoxy- Catalog No.:AA0084UK CAS No.:104090-86-0 MDL No.:MFCD02684170 MF:C10H10N2O MW:174.1992
Fmoc-l-glu(tbu)-nh2 Catalog No.:AA007EOQ CAS No.:104090-92-8 MDL No.:MFCD01075096 MF:C24H28N2O5 MW:424.4895	Fmoc-D-Glu(OtBu)-OH Catalog No.:AA00HA7D CAS No.:104091-08-9 MDL No.:MFCD00077055 MF:C24H27NO6 MW:425.4743
N-[(9H-Fluoren-9-ylmethoxy)carbonyl]-d-glutamic acid Catalog No.:AA003SJN CAS No.:104091-09-0 MDL No.:MFCD09037362 MF:C20H19NO6 MW:369.3680	Fmoc-d-glu(obzl)-oh Catalog No.:AA0084UJ CAS No.:104091-11-4 MDL No.:MFCD00273449 MF:C27H25NO6 MW:459.4905
6-methylnonan-2-one Catalog No.:AA01BVDL CAS No.:104092-42-4 MDL No.:MFCD20336773 MF:C10H20O MW:156.2652	Ethyl 7-chlorocinnoline-3-carboxylate Catalog No.:AA007WH2 CAS No.:104092-54-8 MDL No.:MFCD17926299 MF:C11H9ClN2O2 MW:236.6544
3-tert-Butoxycarbonylamino-piperidine-2-carboxylic acid Catalog No.:AA01EIDN CAS No.:1040921-39-8 MDL No.:MFCD02181060 MF:C11H20N2O4 MW:244.2875	ethyl 5,5-dimethylhexanoate Catalog No.:AA01CA9T CAS No.:104093-22-3 MDL No.:MFCD31457185 MF:C10H20O2 MW:172.2646
3-methyl-4-oxo-4H-chromene-2-carboxylic acid Catalog No.:AA01C51X CAS No.:104094-15-7 MDL No.:MFCD16547113 MF:C11H8O4 MW:204.1788	3-Amino-n-(2-chloro-phenyl)-4-hydroxy-benzenesulfonamide Catalog No.:AA00HA7E CAS No.:104095-22-9 MDL No.:MFCD02704645 MF:C12H11ClN2O3S MW:298.7453
2-(naphthalen-1-yloxy)acetonitrile Catalog No.:AA00IZZ4 CAS No.:104096-13-1 MDL No.:MFCD00245495 MF:C12H9NO MW:183.2060	3-Phenylisonicotinic acid Catalog No.:AA007WGY CAS No.:104096-15-3 MDL No.:MFCD04114253 MF:C12H9NO2 MW:199.2054
Diethyl 3-nitrobenzylphosphonate Catalog No.:AA003PD0 CAS No.:104097-04-3 MDL No.:MFCD22574984 MF:C11H16NO5P MW:273.2222	2-(Naphthalen-2-yloxy)acetonitrile Catalog No.:AA007EOJ CAS No.:104097-35-0 MDL No.:MFCD00245496 MF:C12H9NO MW:183.2060
4-Sec-butoxybenzoic acid Catalog No.:AA008RX7 CAS No.:104097-41-8 MDL No.:MFCD01333527 MF:C11H14O3 MW:194.2271	Imazapic Catalog No.:AA01DQ70 CAS No.:104098-48-8 MDL No.:MFCD04307828 MF:C14H17N3O3 MW:275.3031
Benzoxazole, 2,2'-(1,2-ethenediyl)bis[5-methyl- Catalog No.:AA00IKF8 CAS No.:1041-00-5 MDL No.:MFCD00408425 MF:C18H14N2O2 MW:290.3160	3,5-Diiodo-L-thyronine Catalog No.:AA003IKS CAS No.:1041-01-6 MDL No.:MFCD00064987 MF:C15H13I2NO4 MW:525.0770
6-Methoxy-3-methylbenzofuran-2-carbaldehyde Catalog No.:AA009KLB CAS No.:10410-28-3 MDL No.:MFCD09039305 MF:C11H10O3 MW:190.1953	6-Methoxy-3-methylbenzofuran-2-carboxylic acid Catalog No.:AA008X91 CAS No.:10410-29-4 MDL No.:MFCD00514053 MF:C11H10O4 MW:206.1947
IMidazo[1,2-a]pyridine-2-carboxylic acid, 8-hydroxy-, ethyl ester Catalog No.:AA0096DF CAS No.:1041004-63-0 MDL No.:MFCD05864805 MF:C10H10N2O3 MW:206.1980	2-(3-Oxo-1-(pyridin-2-ylmethyl)piperazin-2-yl)acetic acid Catalog No.:AA01FOD5 CAS No.:1041005-47-3 MDL No.: MF:C12H15N3O3 MW:249.2658
N-[(2S)-2-AMINO-2-PHENYLETHYL]-CARBAMIC ACID PHENYLMETHYL ESTER HYDROCHLORIDE Catalog No.:AA00928W CAS No.:1041016-94-7 MDL No.:MFCD11849125 MF:C16H19ClN2O2 MW:306.7873	(3-(Bromomethyl)-1-(p-toluenesulfonyl)azetidin-3-yl)methanol Catalog No.:AA0084U8 CAS No.:1041026-55-4 MDL No.:MFCD18782897 MF:C12H16BrNO3S MW:334.2293
3,3-Bis(bromomethyl)-1-(p-toluenesulfonyl)azetidine Catalog No.:AA0084U7 CAS No.:1041026-61-2 MDL No.:MFCD18782896 MF:C12H15Br2NO2S MW:397.1260	tert-Butyl 2,6-diazaspiro[3.3]heptane-2-carboxylate Catalog No.:AA007EOD CAS No.:1041026-70-3 MDL No.:MFCD11226963 MF:C10H18N2O2 MW:198.2621
2,6-Diazaspiro[3.3]heptane-2-carboxylic acid tert-butyl ester hemioxylate Catalog No.:AA0037XW CAS No.:1041026-71-4 MDL No.:MFCD12404932 MF:C22H38N4O8 MW:486.5591	4-Methyl-7-nitro-1h-indazole Catalog No.:AA0090W7 CAS No.:104103-06-2 MDL No.:MFCD08689688 MF:C8H7N3O2 MW:177.1601
2-(3-Methoxy-4-nitrophenyl)acetonitrile Catalog No.:AA009SJZ CAS No.:104103-16-4 MDL No.:MFCD13192129 MF:C9H8N2O3 MW:192.1714	Bis[2-(4-methoxyphenoxy)ethyl] ether Catalog No.:AA003OAJ CAS No.:104104-12-3 MDL No.:MFCD00143755 MF:C18H22O5 MW:318.3643
Gabazine Hydrobromide Catalog No.:AA008SDC CAS No.:104104-50-9 MDL No.:MFCD09055424 MF:C15H18BrN3O3 MW:368.2257	Oxazol-2-yl-methylamine, HCl Catalog No.:AA0037XV CAS No.:1041053-44-4 MDL No.:MFCD06738929 MF:C4H7ClN2O MW:134.5642
1-Boc-4-(4-aminopyrimidin-2-yl)piperazine Catalog No.:AA0091ZG CAS No.:1041054-18-5 MDL No.:MFCD09743712 MF:C13H21N5O2 MW:279.3381	(S)-2,6-Diaminohexan-1-ol dihydrochloride Catalog No.:AA00HA7G CAS No.:1041055-24-6 MDL No.:MFCD28401050 MF:C6H18Cl2N2O MW:205.1259
2-(2,4-dimethylphenyl)-1,3-thiazolidine-4-carboxylic acid Catalog No.:AA01AA9P CAS No.:1041059-16-8 MDL No.:MFCD03180319 MF:C12H15NO2S MW:237.3180	3,3-dimethyl-1,2,3,6-tetrahydropyridine-2,6-dione Catalog No.:AA01ABHS CAS No.:10411-16-2 MDL No.:MFCD20728275 MF:C7H9NO2 MW:139.1519
2,3-Dichloroisobutyric acid Catalog No.:AA003FEU CAS No.:10411-52-6 MDL No.:MFCD00068279 MF:C4H6Cl2O2 MW:156.9952	5,5-dimethyl-2-(naphthalen-1-yl)-1,3-thiazolidine-4-carboxylic acid Catalog No.:AA00IV8M CAS No.:1041100-89-3 MDL No.:MFCD01567577 MF:C16H17NO2S MW:287.3767
Phellodendrine Hydrochloride Catalog No.:AA008UVY CAS No.:104112-82-5 MDL No.:MFCD01732398 MF:C20H24ClNO4 MW:377.8619	1-(Naphth-1-yl)piperazine diHCl Catalog No.:AA00HA7H CAS No.:104113-71-5 MDL No.:MFCD00055161 MF:C14H17ClN2 MW:248.7512
Daidzein 7-β-D-Glucuronide 4’-Sulfate Disodium Salt Catalog No.:AA008WDI CAS No.:1041134-19-3 MDL No.:MFCD31562233 MF:C21H16Na2O13S MW:554.3885	4-(3,4-dichlorophenyl)piperidine-2,6-dione Catalog No.:AA01BHRK CAS No.:104115-69-7 MDL No.:MFCD18277004 MF:C11H9Cl2NO2 MW:258.1007
Ethyl 4,7-dichloro-1h-indole-2-carboxylate Catalog No.:AA00HA7J CAS No.:104115-70-0 MDL No.:MFCD04966955 MF:C11H9Cl2NO2 MW:258.1007	3-Methoxynaphthalene-2-boronic acid Catalog No.:AA00386C CAS No.:104115-76-6 MDL No.:MFCD12025968 MF:C11H11BO3 MW:202.0142
2-Methoxynaphthalene-1-boronic acid Catalog No.:AA0084U2 CAS No.:104116-17-8 MDL No.:MFCD11044173 MF:C11H11BO3 MW:202.0142	5,6,7,8-TETRAHYDRO-1H-CYCLOHEPTA[C]FURAN-1,3(4H)-DIONE Catalog No.:AA01DUV0 CAS No.:10412-04-1 MDL No.:MFCD09865945 MF:C9H10O3 MW:166.1739
2-(dichloromethylene)cyclohexanone Catalog No.:AA01DSS6 CAS No.:10412-36-9 MDL No.:MFCD24690284 MF:C7H8Cl2O MW:179.0438	N-Benzyl-2-cyanoacetamide Catalog No.:AA008RMW CAS No.:10412-93-8 MDL No.:MFCD00461336 MF:C10H10N2O MW:174.1992
5-Ketohexanenitrile Catalog No.:AA003MQX CAS No.:10412-98-3 MDL No.:MFCD00010671 MF:C6H9NO MW:111.1418	Methyl 4-bromo-3-ethoxybenzoate Catalog No.:AA019EJI CAS No.:1041205-21-3 MDL No.:MFCD20486187 MF:C10H11BrO3 MW:259.0965
Methyl 3-iodo-1-methyl-1H-indazole-6-carboxylate Catalog No.:AA007EO3 CAS No.:1041205-25-7 MDL No.:MFCD15071434 MF:C10H9IN2O2 MW:316.0951	1-(Difluoromethyl)-4-iodo-1h-pyrazole Catalog No.:AA008Z1H CAS No.:1041205-43-9 MDL No.:MFCD18633160 MF:C4H3F2IN2 MW:243.9813
2-(3-hydroxypropoxy)-1,25-dihydroxyvitamin D3 Catalog No.:AA008TCY CAS No.:104121-92-8 MDL No.:MFCD25977156 MF:C30H50O5 MW:490.7150	Ethyl 2-(4-amino-3-nitrophenyl)acetate Catalog No.:AA00HA7K CAS No.:104126-70-7 MDL No.:MFCD16620936 MF:C10H12N2O4 MW:224.2133
1-{[3-(chloromethyl)phenyl]methyl}piperidine hydrochloride Catalog No.:AA01C337 CAS No.:104126-78-5 MDL No.:MFCD29055220 MF:C13H19Cl2N MW:260.2027	(2E)-3-(4-bromophenyl)-2-cyanoprop-2-enamide Catalog No.:AA00ITOJ CAS No.:104127-29-9 MDL No.:MFCD00457409 MF:C10H7BrN2O MW:251.0794
N-ACETYL-S-(3-CARBOXY-1-METHYLPROPYL)-L-CYSTEINE, DISODIUM SALT Catalog No.:AA008W34 CAS No.:1041285-62-4 MDL No.:MFCD04973536 MF:C9H13NNa2O5S MW:293.2478	methyl 2-amino-4-cyclohexylthiophene-3-carboxylate Catalog No.:AA01B7RU CAS No.:10413-33-9 MDL No.:MFCD08059070 MF:C12H17NO2S MW:239.3339
2-amino-4-tert-butylthiophene-3-carbonitrile Catalog No.:AA00VTIO CAS No.:10413-34-0 MDL No.:MFCD01566461 MF:C9H12N2S MW:180.2700	2-amino-4-isopropylthiophene-3-carbonitrile Catalog No.:AA00946Q CAS No.:10413-35-1 MDL No.:MFCD10695775 MF:C8H10N2S MW:166.2434
Ethyl 2,3,4-trimethoxybenzoate Catalog No.:AA01FEWI CAS No.:10413-86-2 MDL No.:MFCD06204287 MF:C12H16O5 MW:240.2524	1-propylcyclopropane-1-carboxylic acid Catalog No.:AA019ZR6 CAS No.:104131-82-0 MDL No.:MFCD19229807 MF:C7H12O2 MW:128.1690
1-(propan-2-yl)cyclopropane-1-carboxylic acid Catalog No.:AA019YY1 CAS No.:104131-92-2 MDL No.:MFCD19231072 MF:C7H12O2 MW:128.1690	Acriflavin-Biotin Conjugate Catalog No.:AA007WG3 CAS No.:1041387-90-9 MDL No.:MFCD07357256 MF:C25H31N7O2S MW:493.6243
(N-DANSYL)BIOCYTINAMIDOETHYL METHANETHIOSULFONATE Catalog No.:AA008RO3 CAS No.:1041392-69-1 MDL No.:MFCD16872053 MF:C31H46N6O7S4 MW:742.9929	2'-Amino-2'-deoxyadenosine Catalog No.:AA007WBN CAS No.:10414-81-0 MDL No.:MFCD06657636 MF:C10H14N6O3 MW:266.2566
TRIETHOXYSILYLPROPOXY(POLYETHYLENEOXY)DODECANOATE, tech-95 Catalog No.:AA008ZH3 CAS No.:1041420-54-5 MDL No.: MF:C23H48O6Si MW:448.7091	5-Formyl-N,N-dimethylpyrazole-1-sulfonamide Catalog No.:AA009464 CAS No.:1041421-94-6 MDL No.:MFCD23699497 MF:C6H9N3O3S MW:203.2190
1,3-Dichloro-6-fluoroisoquinoline Catalog No.:AA008Z24 CAS No.:1041423-26-0 MDL No.:MFCD11656163 MF:C9H4Cl2FN MW:216.0392	3-Chloro-6-fluoroisoquinoline Catalog No.:AA00HA7N CAS No.:1041423-28-2 MDL No.:MFCD18837816 MF:C9H5ClFN MW:181.5941
methyl(thiophen-3-ylmethyl)amine hydrochloride Catalog No.:AA01EIWE CAS No.:1041424-94-5 MDL No.:MFCD03306022 MF:C6H10ClNS MW:163.6683	1H,4H,5H,6H-Cyclopenta[b]pyrrole-2-carboxylic acid Catalog No.:AA01A54P CAS No.:1041429-45-1 MDL No.:MFCD20645457 MF:C8H9NO2 MW:151.1626
3-(5-(Methoxycarbonyl)-1H-pyrrol-2-yl)propanoic acid Catalog No.:AA01DT8I CAS No.:1041430-19-6 MDL No.:MFCD20660037 MF:C9H11NO4 MW:197.1879	3,5-Dicarboxyphenylboronic acid, pinacol ester Catalog No.:AA0084SP CAS No.:1041434-13-2 MDL No.:MFCD11867793 MF:C14H17BO6 MW:292.0922
Peramivir trihydrate Catalog No.:AA008TG3 CAS No.:1041434-82-5 MDL No.:MFCD09837902 MF:C15H34N4O7 MW:382.4531	N-[(2-FLUOROPHENYL)SULFONYL]LEUCINE Catalog No.:AA01APVZ CAS No.:1041437-98-2 MDL No.:MFCD03618988 MF:C12H16FNO4S MW:289.3231
N-[(3-CHLORO-4-FLUOROPHENYL)SULFONYL]LEUCINE Catalog No.:AA01APVY CAS No.:1041437-99-3 MDL No.:MFCD03618999 MF:C12H15ClFNO4S MW:323.7682	Cefditoren Catalog No.:AA008SKY CAS No.:104145-95-1 MDL No.:MFCD00865118 MF:C19H18N6O5S3 MW:506.5784
Gcle Catalog No.:AA00HA7O CAS No.:104146-10-3 MDL No.:MFCD00191253 MF:C24H23ClN2O5S MW:486.9678	4-Chlorothiazole-5-carboxaldehyde Catalog No.:AA007WBQ CAS No.:104146-17-0 MDL No.:MFCD09837291 MF:C4H2ClNOS MW:147.5828
(2S)-2-amino-2-{bicyclo[2.2.1]hept-5-en-2-yl}acetic acid Catalog No.:AA01FMHI CAS No.:1041465-89-7 MDL No.:MFCD30011211 MF:C9H13NO2 MW:167.2050	3,5-Dichloro-4-(1,1,2,2-tetrafluoroethoxy)aniline Catalog No.:AA0084SI CAS No.:104147-32-2 MDL No.:MFCD10000640 MF:C8H5Cl2F4NO MW:278.0310
4-Fluoro-1h-indazole-5-carboxylic acid Catalog No.:AA00389K CAS No.:1041481-59-7 MDL No.:MFCD11007930 MF:C8H5FN2O2 MW:180.1359	Methyl 4-acetyl-5-methylisoxazole-3-carboxylate Catalog No.:AA007WBM CAS No.:104149-61-3 MDL No.:MFCD00068116 MF:C8H9NO4 MW:183.1614
methyl 4-benzoyl-5-methyl-1,2-oxazole-3-carboxylate Catalog No.:AA01A95B CAS No.:104149-63-5 MDL No.:MFCD16547672 MF:C13H11NO4 MW:245.2307	methyl 5-(4-methoxyphenyl)-1,2,4-oxadiazole-3-carboxylate Catalog No.:AA00IRBJ CAS No.:104149-68-0 MDL No.:MFCD00974505 MF:C11H10N2O4 MW:234.2081
3-Methyl-1-phenylpentan-3-ol Catalog No.:AA003EJF CAS No.:10415-87-9 MDL No.:MFCD00021825 MF:C12H18O MW:178.2707	6-Chloro-n-(3,5-difluorophenyl)pyridine-3-sulfonamide Catalog No.:AA01ABB9 CAS No.:1041507-44-1 MDL No.:MFCD12443439 MF:C11H7ClF2N2O2S MW:304.7003
4-[4-(2-methylpropyl)phenyl]butanoic acid Catalog No.:AA00VTUY CAS No.:1041514-31-1 MDL No.:MFCD11120107 MF:C14H20O2 MW:220.3074	2-[(Piperidine-1-sulfonyl)methyl]benzonitrile Catalog No.:AA00HA7R CAS No.:1041515-38-1 MDL No.:MFCD11120137 MF:C13H16N2O2S MW:264.3433
1-(2-Cyanophenyl)-N-(2-methoxyethyl)methanesulfonamide Catalog No.:AA00HA7S CAS No.:1041527-14-3 MDL No.:MFCD11123401 MF:C11H14N2O3S MW:254.3055	5-(morpholine-4-sulfonyl)thiophene-3-carboxylic acid Catalog No.:AA019UGO CAS No.:1041528-64-6 MDL No.:MFCD11122624 MF:C9H11NO5S2 MW:277.3173
2-Methyl-4-(3-methyl-1,2,4-oxadiazol-5-yl)aniline Catalog No.:AA019VW4 CAS No.:1041529-30-9 MDL No.:MFCD11121317 MF:C10H11N3O MW:189.2138	3-Chloro-4-(cyclohexyloxy)benzene-1-sulfonyl chloride Catalog No.:AA01C377 CAS No.:1041531-84-3 MDL No.:MFCD11122871 MF:C12H14Cl2O3S MW:309.2088
N-(furan-2-ylmethyl)-4-methyl-1,3-thiazol-2-amine Catalog No.:AA01ABY3 CAS No.:1041533-19-0 MDL No.:MFCD11122892 MF:C9H10N2OS MW:194.2535	4-bromo-N-{[4-(trifluoromethyl)phenyl]methyl}aniline Catalog No.:AA01A41H CAS No.:1041538-12-8 MDL No.:MFCD12443795 MF:C14H11BrF3N MW:330.1430
5-(3-fluorophenoxymethyl)-2-methoxyaniline Catalog No.:AA01A7NE CAS No.:1041538-54-8 MDL No.:MFCD11123632 MF:C14H14FNO2 MW:247.2649	5-Bromo-n-(pyridin-2-ylmethyl)pyridin-2-amine Catalog No.:AA01B84F CAS No.:1041542-35-1 MDL No.:MFCD11122322 MF:C11H10BrN3 MW:264.1212
2-(3,4-Dichlorophenyl)-2-(6,7-dihydrothieno[3,2-c]pyridin-5(4h)-yl)ethanamine Catalog No.:AA019UBF CAS No.:1041546-96-6 MDL No.:MFCD11618148 MF:C15H16Cl2N2S MW:327.2719	N-[(2-fluorophenyl)methyl]pyridin-4-amine Catalog No.:AA01AB05 CAS No.:1041551-09-0 MDL No.:MFCD11122588 MF:C12H11FN2 MW:202.2275
2-{[2-(trifluoromethyl)phenyl]amino}benzonitrile Catalog No.:AA01A2T5 CAS No.:1041551-15-8 MDL No.:MFCD12619061 MF:C14H9F3N2 MW:262.2299	3-(1-aminoethyl)-N-methylbenzene-1-sulfonamide Catalog No.:AA01A9ZK CAS No.:1041552-86-6 MDL No.:MFCD11121234 MF:C9H14N2O2S MW:214.2847
ethyl 4-(2,6-dichloro-3-fluorophenyl)-2,4-dioxobutanoate Catalog No.:AA019XXR CAS No.:1041553-00-7 MDL No.:MFCD12548642 MF:C12H9Cl2FO4 MW:307.1019	2-([4-(Propan-2-yl)benzene]amido)thiophene-3-carboxylic acid Catalog No.:AA019V6C CAS No.:1041555-04-7 MDL No.:MFCD12165927 MF:C15H15NO3S MW:289.3495
2-(4-chloro-2-hydroxybenzamido)thiophene-3-carboxylic acid Catalog No.:AA01ABE6 CAS No.:1041557-15-6 MDL No.:MFCD12443778 MF:C12H8ClNO4S MW:297.7142	2-methoxy-5-[(4-methylpiperazin-1-yl)methyl]aniline Catalog No.:AA01AA2J CAS No.:1041561-44-7 MDL No.:MFCD11121421 MF:C13H21N3O MW:235.3253
4-[(Pyrrolidine-1-sulfonyl)methyl]benzonitrile Catalog No.:AA00HA7X CAS No.:1041561-96-9 MDL No.:MFCD11120636 MF:C12H14N2O2S MW:250.3168	1-(4-Cyanophenyl)-N-(2-methoxyethyl)methanesulfonamide Catalog No.:AA00HA7Y CAS No.:1041567-41-2 MDL No.:MFCD11119859 MF:C11H14N2O3S MW:254.3055
1-(3-Methyl-1,2,4-oxadiazol-5-yl)ethan-1-amine hydrochloride Catalog No.:AA008V1A CAS No.:1041578-67-9 MDL No.:MFCD11123108 MF:C5H9N3O MW:127.1445	4-difluoromethanesulfonamido-2-methoxybenzene-1-sulfonyl chloride Catalog No.:AA01A36V CAS No.:1041583-35-0 MDL No.:MFCD12617571 MF:C8H8ClF2NO5S2 MW:335.7326
3-amino-N-tert-butyl-2-methylbenzene-1-sulfonamide Catalog No.:AA01AK6M CAS No.:1041583-63-4 MDL No.:MFCD11121573 MF:C11H18N2O2S MW:242.3378	1-phenyl-2-(trifluoromethoxy)ethan-1-one Catalog No.:AA01AJP2 CAS No.:104159-53-7 MDL No.:MFCD17976633 MF:C9H7F3O2 MW:204.1459
5-amino-N-cyclopropyl-2-methoxybenzene-1-sulfonamide Catalog No.:AA01AK30 CAS No.:1041593-92-3 MDL No.:MFCD11120446 MF:C10H14N2O3S MW:242.2948	3-(2,4-di-tert-butylphenoxy)propanenitrile Catalog No.:AA01AA27 CAS No.:1041594-75-5 MDL No.:MFCD12737040 MF:C17H25NO MW:259.3865
N-(3-ethoxypropyl)pyridin-4-amine Catalog No.:AA01C08X CAS No.:1041597-12-9 MDL No.:MFCD11121339 MF:C10H16N2O MW:180.2468	N,O-Bis(trimethylsilyl)acetamide Catalog No.:AA00396J CAS No.:10416-59-8 MDL No.:MFCD00008270 MF:C8H21NOSi2 MW:203.4294
5-methyl-4,5-dihydro-1,3-thiazol-2-amine hydrochloride Catalog No.:AA01B8SC CAS No.:10416-82-7 MDL No.:MFCD00727985 MF:C4H9ClN2S MW:152.6457	N-tert-Butyl-1-(4-cyanophenyl)methanesulfonamide Catalog No.:AA00HA80 CAS No.:1041602-66-7 MDL No.:MFCD11123761 MF:C12H16N2O2S MW:252.3326
N-(3-Aminophenyl)-n'-cyclopropylurea Catalog No.:AA00HA81 CAS No.:1041603-13-7 MDL No.:MFCD10686667 MF:C10H13N3O MW:191.2297	2-methyl-1-(3-methyl-1,2,4-oxadiazol-5-yl)propan-1-amine Catalog No.:AA01AHHE CAS No.:1041603-68-2 MDL No.:MFCD11122292 MF:C7H13N3O MW:155.1976
5-bromo-N-[2-(pyridin-2-yl)ethyl]pyridin-2-amine Catalog No.:AA01B8C8 CAS No.:1041604-47-0 MDL No.:MFCD11122303 MF:C12H12BrN3 MW:278.1478	1-(2-hydroxyethyl)-6-oxo-1,6-dihydropyridine-3-carboxylic acid Catalog No.:AA01DUV2 CAS No.:1041605-13-3 MDL No.:MFCD11122312 MF:C8H9NO4 MW:183.1614
4-(Naphthalen-1-yloxy)benzonitrile Catalog No.:AA01B8TI CAS No.:1041608-24-5 MDL No.:MFCD12737236 MF:C17H11NO MW:245.2753	2-[4-(2-methylbutan-2-yl)cyclohexyl]acetic acid Catalog No.:AA01B8G9 CAS No.:1041608-95-0 MDL No.:MFCD11123268 MF:C13H24O2 MW:212.3285
1-Propanamine, N,N-dimethyl-2,3-bis[(9Z)-9-octadecenyloxy]- Catalog No.:AA007EJQ CAS No.:104162-47-2 MDL No.:MFCD22200991 MF:C41H81NO2 MW:620.0873	N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium Catalog No.:AA003S4C CAS No.:104162-48-3 MDL No.:MFCD00145456 MF:C42H84ClNO2 MW:670.5749
(5-ethylthiophen-2-yl)methanamine Catalog No.:AA019ND9 CAS No.:104162-80-3 MDL No.:MFCD00966033 MF:C7H11NS MW:141.2339	(5-Methylthiophen-2-yl)methanamine Catalog No.:AA0084S8 CAS No.:104163-34-0 MDL No.:MFCD00965306 MF:C6H9NS MW:127.2074
(3-Methyl-2-thienyl)methylamine Catalog No.:AA003BQ0 CAS No.:104163-35-1 MDL No.:MFCD02093988 MF:C6H9NS MW:127.2074	(5-Methylthiophen-3-yl)methanamine Catalog No.:AA01AOZL CAS No.:104163-37-3 MDL No.:MFCD19213738 MF:C6H9NS MW:127.2074
(4-methylthiophen-3-yl)methanamine Catalog No.:AA00919X CAS No.:104163-38-4 MDL No.:MFCD23774679 MF:C6H9NS MW:127.2074	(4-Methyl-2-thienyl)methylamine Catalog No.:AA008TVL CAS No.:104163-39-5 MDL No.:MFCD06657973 MF:C6H9NS MW:127.2074
[4-[4-[3-Oxo-6′-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)spiro[isobenzofuran-1(3H),9′-[9H]xanthen]-3′-yl]-1-piperazinyl]butyl]triphenyl-phosphonium iodide Catalog No.:AA0096U3 CAS No.:1041634-69-8 MDL No.:MFCD22683825 MF:C52H53BIN2O5P MW:954.6769	Silane, germylidynetris[trimethyl- Catalog No.:AA01EIC0 CAS No.:104164-54-7 MDL No.:MFCD00192566 MF:C9H27GeSi3 MW:292.2072
Potassium isopropyltrifluoroborate Catalog No.:AA008R5U CAS No.:1041642-13-0 MDL No.:MFCD04112718 MF:C3H7BF3K MW:149.9922	Potassium trans-2-methylcyclohexyltrifluoroborate Catalog No.:AA00364L CAS No.:1041642-14-1 MDL No.:MFCD28955335 MF:C7H13BF3K MW:204.0826
1-Isopropyl-1h-pyrrole-2-carboxylic acid Catalog No.:AA00J2EN CAS No.:1041644-48-7 MDL No.:MFCD08704773 MF:C8H11NO2 MW:153.1784	methyl 5-cyano-1-methyl-1H-pyrrole-2-carboxylate Catalog No.:AA01C1V3 CAS No.:1041644-52-3 MDL No.:MFCD12924329 MF:C8H8N2O2 MW:164.1613
11beta,17alpha,21-Trihydroxy-16alpha-Methyl-1,4-pregnadiene-3,20-dione Catalog No.:AA008UHF CAS No.:10417-63-7 MDL No.:MFCD28358923 MF:C22H30O5 MW:374.4706	Eicosapentaenoic acid Catalog No.:AA0037XT CAS No.:10417-94-4 MDL No.:MFCD00065716 MF:C20H30O2 MW:302.4510
TETRAPHENYLARSONIUM CHLORIDE MONOHYDRATE Catalog No.:AA008VFB CAS No.:104170-16-3 MDL No.:MFCD00011908 MF:C24H22AsClO MW:436.8055	Benzyl 5-chlorospiro[indoline-3,4'-piperidine]-1'-carboxylate Catalog No.:AA009KSB CAS No.:1041704-16-8 MDL No.:MFCD15071703 MF:C20H21ClN2O2 MW:356.8459
1-(4-Methoxy-2,5-dimethylphenyl)ethan-1-one Catalog No.:AA01A68X CAS No.:104174-28-9 MDL No.:MFCD11553435 MF:C11H14O2 MW:178.2277	4-(Butan-2-yloxy)benzaldehyde Catalog No.:AA01F69P CAS No.:104174-29-0 MDL No.:MFCD02629648 MF:C11H14O2 MW:178.2277
1-(4,5-dimethoxy-2-methylphenyl)ethan-1-amine hydrochloride Catalog No.:AA01AHBC CAS No.:104174-56-3 MDL No.:MFCD18483305 MF:C11H18ClNO2 MW:231.7191	[1-(3,4-Dimethoxyphenyl)propyl]amine hydrochloride Catalog No.:AA00J1YX CAS No.:104174-57-4 MDL No.:MFCD18483503 MF:C11H18ClNO2 MW:231.7191
3-(4-Ethylphenyl)propanal Catalog No.:AA008XEC CAS No.:104175-15-7 MDL No.:MFCD09028621 MF:C11H14O MW:162.2283	2,4-Diethylbenzoic acid Catalog No.:AA003ANN CAS No.:104175-23-7 MDL No.:MFCD20641288 MF:C11H14O2 MW:178.2277
Ethyl 2,3-dimethylbenzoate Catalog No.:AA008Z7K CAS No.:104175-24-8 MDL No.:MFCD00017523 MF:C11H14O2 MW:178.2277	2,6-Dimethylquinoline-4-carboxylic acid Catalog No.:AA0084RV CAS No.:104175-33-9 MDL No.:MFCD00487548 MF:C12H11NO2 MW:201.2212
1-BIOTINYLAMINO-3,6,9-TRIOXAUNDECANE-11-BROMIDE Catalog No.:AA008WXR CAS No.:1041766-91-9 MDL No.:MFCD03701138 MF:C18H32BrN3O5S MW:482.4328	(2-amino-1-phenylpropyl)dimethylamine Catalog No.:AA01ACT6 CAS No.:104177-54-0 MDL No.:MFCD16061675 MF:C11H18N2 MW:178.2740
2-(3-methylbutyl)aniline Catalog No.:AA01A7OX CAS No.:104177-71-1 MDL No.:MFCD14705797 MF:C11H17N MW:163.2594	methyl(2-methyl-3-phenylpropyl)amine Catalog No.:AA01DX52 CAS No.:104178-02-1 MDL No.:MFCD16781918 MF:C11H17N MW:163.2594
1-N-butyl-1-N-methylbenzene-1,4-diamine Catalog No.:AA01AGJH CAS No.:104178-20-3 MDL No.:MFCD09803412 MF:C11H18N2 MW:178.2740	[1-(2-methoxyphenyl)propyl](methyl)amine Catalog No.:AA01BBCP CAS No.:104178-98-5 MDL No.:MFCD10032966 MF:C11H17NO MW:179.2588
1-(4-Propoxyphenyl)ethanamine Catalog No.:AA00J30Z CAS No.:104179-00-2 MDL No.:MFCD09045402 MF:C11H17NO MW:179.2588	2-butoxy-5-methoxyaniline Catalog No.:AA019MVG CAS No.:104179-24-0 MDL No.:MFCD09734725 MF:C11H17NO2 MW:195.2582
methyl 3-hydroxy-2-methylquinoline-4-carboxylate Catalog No.:AA00HA83 CAS No.:104179-54-6 MDL No.:MFCD27578194 MF:C12H11NO3 MW:217.2206	4,4-DiMethyl Retinoic Acid Catalog No.:AA009234 CAS No.:104182-09-4 MDL No.:MFCD31562236 MF:C22H32O2 MW:328.4883
AZD7507 Catalog No.:AA01ENYE CAS No.:1041852-85-0 MDL No.:MFCD28160337 MF:C23H27FN6O3 MW:454.4973	5-hydroxy-7-methyl-2,3-dihydro-1h-indole-2,3-dione Catalog No.:AA01DX53 CAS No.:1041857-41-3 MDL No.:MFCD22556675 MF:C9H7NO3 MW:177.1568
4-(4-Aminophenoxy)pyridin-2(1h)-one Catalog No.:AA0093X4 CAS No.:1041861-94-2 MDL No.:MFCD24038953 MF:C11H10N2O2 MW:202.2093	5-Chloro-7h-pyrrolo[2,3-d]pyrimidine Catalog No.:AA00991C CAS No.:1041864-02-1 MDL No.:MFCD12031334 MF:C6H4ClN3 MW:153.5691
5,5-dimethyl-2-[4-(2-methylpropyl)phenyl]-1,3-thiazolidine-4-carboxylic acid Catalog No.:AA00IWZQ CAS No.:1041870-96-5 MDL No.:MFCD00955335 MF:C16H23NO2S MW:293.4243	Benzeneacetic acid, 2-(methylthio)- Catalog No.:AA007YBY CAS No.:10419-34-8 MDL No.:MFCD11898922 MF:C9H10O2S MW:182.2395
2H-1-Benzopyran, 2-ethoxy-3,4-dihydro- Catalog No.:AA00865U CAS No.:10419-35-9 MDL No.:MFCD21603845 MF:C11H14O2 MW:178.2277	N-Benzoyl-D-phenylglycine Catalog No.:AA007YBX CAS No.:10419-67-7 MDL No.:MFCD02684297 MF:C15H13NO3 MW:255.2686